ID: 1179582718

View in Genome Browser
Species Human (GRCh38)
Location 21:42353595-42353617
Sequence AAGGATAAACAGAAAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179582718_1179582726 13 Left 1179582718 21:42353595-42353617 CCCTCCTCTTTCTGTTTATCCTT No data
Right 1179582726 21:42353631-42353653 CACTTCCATTTTGCACACTTTGG No data
1179582718_1179582727 14 Left 1179582718 21:42353595-42353617 CCCTCCTCTTTCTGTTTATCCTT No data
Right 1179582727 21:42353632-42353654 ACTTCCATTTTGCACACTTTGGG No data
1179582718_1179582728 15 Left 1179582718 21:42353595-42353617 CCCTCCTCTTTCTGTTTATCCTT No data
Right 1179582728 21:42353633-42353655 CTTCCATTTTGCACACTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179582718 Original CRISPR AAGGATAAACAGAAAGAGGA GGG (reversed) Intergenic
No off target data available for this crispr