ID: 1179583282

View in Genome Browser
Species Human (GRCh38)
Location 21:42358574-42358596
Sequence GATGAGAAGGCCGCATCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179583282_1179583286 7 Left 1179583282 21:42358574-42358596 CCCTGTGATGCGGCCTTCTCATC No data
Right 1179583286 21:42358604-42358626 CTCCCTAATGACGTTCTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179583282 Original CRISPR GATGAGAAGGCCGCATCACA GGG (reversed) Intergenic
No off target data available for this crispr