ID: 1179583283

View in Genome Browser
Species Human (GRCh38)
Location 21:42358575-42358597
Sequence GGATGAGAAGGCCGCATCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179583283_1179583286 6 Left 1179583283 21:42358575-42358597 CCTGTGATGCGGCCTTCTCATCC No data
Right 1179583286 21:42358604-42358626 CTCCCTAATGACGTTCTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179583283 Original CRISPR GGATGAGAAGGCCGCATCAC AGG (reversed) Intergenic
No off target data available for this crispr