ID: 1179583286

View in Genome Browser
Species Human (GRCh38)
Location 21:42358604-42358626
Sequence CTCCCTAATGACGTTCTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179583279_1179583286 27 Left 1179583279 21:42358554-42358576 CCTAGAGCACACCATCGGTTCCC No data
Right 1179583286 21:42358604-42358626 CTCCCTAATGACGTTCTTGTTGG No data
1179583282_1179583286 7 Left 1179583282 21:42358574-42358596 CCCTGTGATGCGGCCTTCTCATC No data
Right 1179583286 21:42358604-42358626 CTCCCTAATGACGTTCTTGTTGG No data
1179583283_1179583286 6 Left 1179583283 21:42358575-42358597 CCTGTGATGCGGCCTTCTCATCC No data
Right 1179583286 21:42358604-42358626 CTCCCTAATGACGTTCTTGTTGG No data
1179583284_1179583286 -6 Left 1179583284 21:42358587-42358609 CCTTCTCATCCTTTTCTCTCCCT No data
Right 1179583286 21:42358604-42358626 CTCCCTAATGACGTTCTTGTTGG No data
1179583281_1179583286 16 Left 1179583281 21:42358565-42358587 CCATCGGTTCCCTGTGATGCGGC No data
Right 1179583286 21:42358604-42358626 CTCCCTAATGACGTTCTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179583286 Original CRISPR CTCCCTAATGACGTTCTTGT TGG Intergenic
No off target data available for this crispr