ID: 1179586289

View in Genome Browser
Species Human (GRCh38)
Location 21:42375974-42375996
Sequence CCATTGGGACATCATGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179586289_1179586298 -2 Left 1179586289 21:42375974-42375996 CCCCCTTCATGATGTCCCAATGG 0: 1
1: 0
2: 3
3: 11
4: 107
Right 1179586298 21:42375995-42376017 GGATGACCCAGGTTACAGAAGGG 0: 1
1: 0
2: 0
3: 11
4: 139
1179586289_1179586297 -3 Left 1179586289 21:42375974-42375996 CCCCCTTCATGATGTCCCAATGG 0: 1
1: 0
2: 3
3: 11
4: 107
Right 1179586297 21:42375994-42376016 TGGATGACCCAGGTTACAGAAGG 0: 1
1: 0
2: 0
3: 10
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179586289 Original CRISPR CCATTGGGACATCATGAAGG GGG (reversed) Intronic
905473944 1:38212698-38212720 CCTTTGGGAAATCACGAGGGTGG - Intergenic
909266104 1:73559456-73559478 TCATTGGAACATCAGCAAGGGGG - Intergenic
909520753 1:76565152-76565174 CCATTGGGTCAGCATTAAGGGGG + Intronic
916560980 1:165933924-165933946 CCAGTGGGGCAACATGAAGGTGG + Intergenic
917518665 1:175730120-175730142 GCATTGGGCCTTCATGCAGGCGG - Intronic
921435276 1:215112231-215112253 CCAGTGAGACATGATTAAGGTGG + Intronic
921732007 1:218589023-218589045 CTATTGTGAAATGATGAAGGCGG - Intergenic
1062882661 10:990902-990924 CCGTTCGCACATCCTGAAGGGGG - Intronic
1074725919 10:116309609-116309631 CCTTGGGGAAATCATGCAGGCGG + Intergenic
1075565242 10:123498756-123498778 CCATTGAGGCTTCATGGAGGAGG - Intergenic
1078007133 11:7540453-7540475 CCATGGGGGCATCACCAAGGTGG + Intronic
1078241599 11:9535418-9535440 CCATTGGGACATCACTAAAGAGG + Intergenic
1081068330 11:38576654-38576676 CTATTAGGGCATCATGGAGGGGG - Intergenic
1091230255 11:133983733-133983755 CCATTCTTACATAATGAAGGAGG - Intergenic
1092098195 12:5861586-5861608 CCCTTGGGTCAGCATGGAGGTGG - Intronic
1098351430 12:69565698-69565720 CCAGTGGGACAACATGTAGGAGG - Intronic
1107519771 13:41167985-41168007 CCTTTGGGAGGTCATGAGGGTGG + Intergenic
1111198638 13:84905685-84905707 CCATTGAGAGATCATAGAGGTGG - Intergenic
1114472991 14:22976579-22976601 CCAATGGGCCACCAAGAAGGGGG + Intronic
1115668553 14:35582466-35582488 CCAGTGGGACACCAGGAATGGGG - Intronic
1115921936 14:38384490-38384512 CAATTAGGACATGATGAAGCTGG + Intergenic
1116859234 14:49980546-49980568 CCATGGGGACATCATAGGGGTGG - Intergenic
1117578234 14:57123338-57123360 CCATTGTAACAGTATGAAGGTGG - Intergenic
1118742737 14:68752164-68752186 CCACTGGGACCTGATCAAGGAGG - Intergenic
1121091698 14:91187469-91187491 ACAATGGGACCTCATGAGGGCGG + Intronic
1122035179 14:98943816-98943838 GAATTGGGACATCATGAACTTGG + Intergenic
1122717671 14:103705379-103705401 TCATGGGGACATCGTGAAGCTGG + Intronic
1123974494 15:25540371-25540393 GCATTGGGAGACCAAGAAGGTGG - Intergenic
1128820804 15:70651211-70651233 CAATTGGGATAACCTGAAGGAGG - Intergenic
1129809956 15:78502216-78502238 CTATTGGGACAACACCAAGGGGG + Intergenic
1132059591 15:98681230-98681252 CGATTGTGACATCTTGAGGGCGG + Intronic
1136230408 16:28882564-28882586 CCCTGGGGACATCGTGGAGGTGG + Exonic
1136997535 16:35201081-35201103 CCCTTGGTGGATCATGAAGGAGG + Intergenic
1138974368 16:62186136-62186158 CCAATGGGACATCAGGATGGAGG + Intergenic
1139507562 16:67406840-67406862 GCATTTGGACCTCAGGAAGGAGG - Intronic
1142316853 16:89352797-89352819 CCATGTGGTCATCTTGAAGGAGG - Intronic
1144802006 17:17935736-17935758 CCATTAGGACATAAGGAACGAGG + Intronic
1144946291 17:18971245-18971267 CCACTGGGACGGCAGGAAGGTGG - Exonic
1147951972 17:44112474-44112496 CAACTGTGACATCAGGAAGGGGG - Intronic
1149608582 17:57942300-57942322 CCATTCGCACCCCATGAAGGTGG - Intronic
1151388059 17:73767535-73767557 CCACTGGGACATGAGCAAGGTGG + Intergenic
1154381017 18:13849868-13849890 TCAACGGGAAATCATGAAGGAGG + Intergenic
1155076613 18:22362813-22362835 CCAGTTGCACATCATGAAGATGG - Intergenic
1162178413 19:8848755-8848777 CCTTTGGGACTTCACGAAGGTGG + Intergenic
1163731459 19:18951929-18951951 CCCTTGGGACAGCATTGAGGAGG + Intergenic
926346931 2:11955525-11955547 CCCTTGGGACAACAGGCAGGAGG + Intergenic
930028215 2:47042775-47042797 ACATAGGGACATCTTGGAGGAGG + Intronic
932695747 2:73954658-73954680 GCATGGGGACAGCATGCAGGAGG + Intronic
935581619 2:104760721-104760743 CCAGTGTGACATCATGGAAGAGG + Intergenic
937953299 2:127404893-127404915 CCATTTGGCTATCAGGAAGGAGG - Intergenic
940039676 2:149347266-149347288 CCTTTGGGAGATCATGATGGTGG - Intronic
944217181 2:197268114-197268136 CCCTTGGGCCATGGTGAAGGAGG - Intronic
1172576815 20:36015658-36015680 CCATTGGGAGATCTTTTAGGTGG - Intronic
1179586289 21:42375974-42375996 CCATTGGGACATCATGAAGGGGG - Intronic
1183538607 22:38417129-38417151 ACTTTGTGGCATCATGAAGGTGG - Intergenic
1184021560 22:41825080-41825102 CATTTGGGACATCCTAAAGGAGG + Intronic
951052870 3:18114159-18114181 CCATTGGGCCATCATGCAGAAGG - Intronic
955941822 3:64153254-64153276 CCAGCGCTACATCATGAAGGAGG - Exonic
960488453 3:118281223-118281245 CCATTGAGCCACCATGATGGTGG - Intergenic
962409290 3:135127437-135127459 CCATTGGGTGATGGTGAAGGTGG - Intronic
962706160 3:138046728-138046750 TCATACGGACATCATGAAGTGGG - Intergenic
964430650 3:156602910-156602932 CCATGGGGTCATCATGAAAGTGG + Intergenic
968482722 4:843549-843571 CCAGTGGGACATCTGGACGGAGG + Intergenic
971142347 4:23937899-23937921 CCTTTGGGACATTGTGAAAGGGG - Intergenic
972386865 4:38575299-38575321 ACATTGGGACATCATGCTGGAGG - Intergenic
976152638 4:82107516-82107538 CGATTGGGAAAGCAGGAAGGAGG + Intergenic
977770622 4:100853681-100853703 ACATTGGTATATCAGGAAGGAGG - Intronic
982546887 4:156745030-156745052 ACATTAGGACATTATCAAGGAGG - Intergenic
983406866 4:167342431-167342453 CCACTGGTACATCATTTAGGTGG - Intergenic
983596917 4:169479473-169479495 CCTTTGGGACAGCATGAAACAGG - Exonic
992750851 5:79859271-79859293 CCAGTGCCACATCATGAAAGGGG + Intergenic
996523804 5:124455798-124455820 CCGTTGTGACTTTATGAAGGTGG + Intergenic
996530189 5:124520452-124520474 CCTATGGAACTTCATGAAGGAGG + Intergenic
999140167 5:149355827-149355849 CCAGTGAGCCATCTTGAAGGTGG + Intergenic
1000321958 5:160141575-160141597 CCATAGGGCTATCATGAAGATGG - Intergenic
1001426984 5:171629235-171629257 CCATGGGGGCACCATGATGGGGG + Intergenic
1003395907 6:5751765-5751787 TCATTGGCTTATCATGAAGGAGG - Intronic
1006574320 6:35033075-35033097 CCAATGTGACATTATCAAGGGGG - Intronic
1008021707 6:46585914-46585936 CCAATGGGACAGGATGAACGGGG + Intronic
1008561430 6:52728595-52728617 CAATTTGGACTTCATGGAGGGGG - Intergenic
1010384863 6:75268468-75268490 CTATTGGGACTTCATGATGTAGG - Intronic
1010478235 6:76316480-76316502 CCTTTGGGAGGTCATGAGGGTGG - Intergenic
1019154414 6:170029577-170029599 CTGCCGGGACATCATGAAGGAGG - Intergenic
1023865536 7:44236499-44236521 GCCTTGGGACATCAGGGAGGTGG - Intronic
1024125088 7:46286035-46286057 AAGTTGGGACATCAAGAAGGTGG - Intergenic
1028888618 7:95961969-95961991 ACCTGGGCACATCATGAAGGAGG - Intronic
1030476496 7:110040297-110040319 ACATTGAGAGATCATAAAGGAGG - Intergenic
1030678261 7:112407499-112407521 CAATTGTGACATCCTGAAGATGG + Intergenic
1032475490 7:132208820-132208842 CCATGGGGACACCATGAAGGAGG + Intronic
1034534633 7:151719304-151719326 CAAGTGGGACTTTATGAAGGAGG + Intronic
1036503506 8:9334856-9334878 CCATTGGGAGGTAATGAGGGTGG + Intergenic
1038614141 8:29077123-29077145 CCAATGGGACAGAATGAGGGAGG + Intronic
1038986916 8:32821384-32821406 CCATTGGATAAACATGAAGGGGG - Intergenic
1040012369 8:42672827-42672849 CCATGAGGACATTGTGAAGGCGG - Intergenic
1040532855 8:48279734-48279756 CCATTGGGATATCAAGTAGAGGG - Intergenic
1041448056 8:57975348-57975370 TCATTGGGGCAACATGAAGTAGG + Intergenic
1042786366 8:72551133-72551155 ATAGTGGAACATCATGAAGGTGG - Intronic
1044081210 8:87886886-87886908 CCATAGGGACAACATGAAGGAGG - Intergenic
1044374726 8:91456438-91456460 CCTTTGAGAGATCTTGAAGGTGG - Intergenic
1045309600 8:100989458-100989480 CACTTGTGACATCATGAAGTTGG + Intergenic
1046060572 8:109134595-109134617 CCTTTGGGAAAGCATGGAGGAGG + Intergenic
1046302644 8:112317642-112317664 CTATTAGGACATCTTGAAGTTGG - Intronic
1048304757 8:133276175-133276197 CCCTTAGGACATCATTAAAGTGG - Intronic
1048574129 8:135677748-135677770 CCATTAGGACATCATGAAGATGG + Intergenic
1049515889 8:143055263-143055285 CCATTGAGACATCAGGCAGCAGG + Intronic
1056017508 9:82405987-82406009 CCATTGAGACAACATGGAAGTGG + Intergenic
1057313901 9:93957159-93957181 CCATTGGGACTGAAAGAAGGTGG + Intergenic
1059009160 9:110437871-110437893 AGATTGGGAAATCATGAAGGAGG - Intronic
1061268286 9:129521261-129521283 CCTTTGGGAGCTCATGGAGGCGG - Intergenic
1061897992 9:133658467-133658489 CCACAGGGACAGCATGGAGGAGG - Exonic
1062232986 9:135493021-135493043 CCTTGGGGACATCCTGGAGGCGG - Intergenic
1062572344 9:137191454-137191476 CCACTGGGACATCAAGGAGTGGG + Intergenic
1186035907 X:5423461-5423483 CCTTTGGGAGGTCATGAGGGTGG + Intergenic
1186877440 X:13830131-13830153 CTCATGGGACATCATGAATGTGG - Intronic
1187213925 X:17256184-17256206 CCAATGGGACACCATCAAGTGGG + Intergenic
1187277087 X:17825627-17825649 ACACTGGGAAATCATCAAGGGGG + Intronic
1191938099 X:66447086-66447108 CAGTTGGGACAGCATGAAAGTGG + Intergenic
1195175082 X:102306854-102306876 CATTTGGTACATCATGAAAGCGG + Intergenic
1195183783 X:102380239-102380261 CATTTGGTACATCATGAAAGCGG - Intronic
1198343126 X:135733965-135733987 CCATTGGAAGGTCATGAAAGTGG + Intergenic
1198344863 X:135749330-135749352 CCATTGGAAGGTCATGAAAGTGG - Intergenic
1200791661 Y:7304864-7304886 CCTTTGGGAGGTCATGAGGGTGG - Intergenic