ID: 1179587014

View in Genome Browser
Species Human (GRCh38)
Location 21:42379922-42379944
Sequence AGTCACGGTTCCATTGTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 51}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179587014_1179587017 -3 Left 1179587014 21:42379922-42379944 CCCATAACAATGGAACCGTGACT 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1179587017 21:42379942-42379964 ACTCCTGACCCACAGTTCCTTGG 0: 1
1: 0
2: 0
3: 19
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179587014 Original CRISPR AGTCACGGTTCCATTGTTAT GGG (reversed) Intronic
903411295 1:23145655-23145677 AGACAGGGTTTCATCGTTATTGG + Intronic
904172219 1:28599411-28599433 AGTCAGGGTCCCACTGTTAGTGG - Intronic
905536633 1:38727590-38727612 AATCACGCTTCTATTGTTACAGG - Intergenic
905619283 1:39428290-39428312 ATTCATGTTTCCATTTTTATTGG + Intronic
907746399 1:57218025-57218047 TGTCACGTTTCCATAATTATGGG - Intronic
1074652302 10:115537628-115537650 AGTCACTTTTTCATTGTTAGAGG + Intronic
1078483551 11:11701393-11701415 GGTCAAGGTTCCAGTTTTATAGG - Intergenic
1088482613 11:110309264-110309286 AATCACAGTTACATTGTTAATGG + Intergenic
1091015761 11:132049655-132049677 AGTCACGCTGCCATTGAGATAGG - Intronic
1092408703 12:8238356-8238378 AGTGAGGGTTCCAGTGTTGTGGG + Intergenic
1093224673 12:16467432-16467454 AGTCACAGTTCCATTTTAAAAGG - Intronic
1093503032 12:19834026-19834048 ACACACGGTTCCATTTTTCTAGG + Intergenic
1100772292 12:97936703-97936725 AATCAAGGTTCCATCTTTATGGG - Intergenic
1103807696 12:123586111-123586133 AGTCACAGTTCCATGTTTGTTGG + Intronic
1113212212 13:107996543-107996565 CTTCATGGTTCCATTGTGATAGG + Intergenic
1128775710 15:70318557-70318579 ACTCACGTTTCCATTTTTACAGG - Intergenic
1138099895 16:54244221-54244243 AGCAACGGTTCCACTGTCATTGG - Intergenic
1140945353 16:79763274-79763296 TGTCACGGGTCGATTGTGATTGG + Intergenic
1141150576 16:81562090-81562112 AGTGAGGGTTCCATGGTTGTTGG + Intronic
1150584760 17:66507435-66507457 AGTGAAGGTTCCATTTTTGTGGG + Intronic
935364160 2:102271678-102271700 ACTTACTGTTCCATTGTTAATGG + Intergenic
937524801 2:122755195-122755217 AGTCAAGGTTTCATTTATATAGG + Intergenic
940665064 2:156598931-156598953 AGTCAAGTTTGCATTGCTATTGG - Intronic
944022994 2:195127588-195127610 AGTCAAGGTTCCATTAGCATGGG + Intergenic
1169964614 20:11202116-11202138 AGTCACCATTCCATTGCTATTGG - Intergenic
1174875758 20:54224525-54224547 GGTCATGGGTCCATAGTTATTGG + Intronic
1174993550 20:55540679-55540701 AGTCACAGTTCCATTCCTCTTGG - Intergenic
1179587014 21:42379922-42379944 AGTCACGGTTCCATTGTTATGGG - Intronic
949168037 3:964017-964039 AGTCAGAGTTCTATTTTTATAGG + Intergenic
952053641 3:29416743-29416765 ACTCAAGGTTCTATTGTGATAGG + Intronic
953673887 3:44985188-44985210 AGACACAGTTACATAGTTATGGG + Intronic
956669074 3:71669607-71669629 AGTCACTGATGCATTTTTATGGG + Intergenic
961240239 3:125404435-125404457 AATCAAGGGGCCATTGTTATTGG + Intergenic
967527015 3:190506708-190506730 AGCCACGGTTCCTTCATTATAGG - Intergenic
969867717 4:10086399-10086421 AGTCACGGTTCCTTTGTGCCGGG - Intronic
969920304 4:10532015-10532037 ATTCAGGGTTCATTTGTTATAGG - Intronic
970137511 4:12941772-12941794 AGTCTCGGTTACATTTTTAAAGG - Intergenic
970314752 4:14818535-14818557 AGTGCCTGGTCCATTGTTATGGG + Intergenic
973264814 4:48200560-48200582 AATCAGGGTTCCATTATTAGTGG - Intronic
977870509 4:102084929-102084951 AGTCTCCTTTCAATTGTTATAGG + Intergenic
977882004 4:102215756-102215778 AGTCTCCTTTCAATTGTTATAGG - Intergenic
980652101 4:135731077-135731099 AGCCAGGGTTGCATTGTCATTGG + Intergenic
995058345 5:107787273-107787295 TGACACGTTTCCATTGTTAATGG - Intergenic
1007304543 6:40893697-40893719 AGTTACTGTTGCATCGTTATTGG - Intergenic
1008159865 6:48063898-48063920 AGTTACTGTTCCATTGAGATTGG + Intronic
1010115855 6:72309449-72309471 AGTCCCAAATCCATTGTTATAGG - Intronic
1012518419 6:100091323-100091345 AGTCTCTGTTTCATTGTTATTGG + Intergenic
1033999555 7:147395401-147395423 AGTCAGGGTTGAATTGTAATGGG - Intronic
1037434701 8:18850358-18850380 GGTCTCAGATCCATTGTTATAGG - Intronic
1041554688 8:59140108-59140130 AGTCTTGTTTCCATTGTTGTTGG - Intergenic
1042401855 8:68358883-68358905 AGGCACGGTTTCACTGTTGTTGG + Intronic
1048123830 8:131611074-131611096 AGTCACTGTTTAATGGTTATAGG - Intergenic
1059347691 9:113641277-113641299 AGTCACTGTTTCATTGACATTGG + Intergenic
1061688680 9:132306106-132306128 AGGCAGGGTTCCCTCGTTATGGG - Intronic