ID: 1179587549

View in Genome Browser
Species Human (GRCh38)
Location 21:42383324-42383346
Sequence CTCTAAGACAAGTGCTGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 133}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179587542_1179587549 10 Left 1179587542 21:42383291-42383313 CCTCACTGCCCCTGCTCCCAGAG 0: 1
1: 0
2: 4
3: 80
4: 571
Right 1179587549 21:42383324-42383346 CTCTAAGACAAGTGCTGCAAGGG 0: 1
1: 0
2: 1
3: 8
4: 133
1179587539_1179587549 15 Left 1179587539 21:42383286-42383308 CCCACCCTCACTGCCCCTGCTCC 0: 1
1: 0
2: 14
3: 113
4: 940
Right 1179587549 21:42383324-42383346 CTCTAAGACAAGTGCTGCAAGGG 0: 1
1: 0
2: 1
3: 8
4: 133
1179587545_1179587549 0 Left 1179587545 21:42383301-42383323 CCTGCTCCCAGAGCTCACAGCAG 0: 1
1: 0
2: 3
3: 50
4: 408
Right 1179587549 21:42383324-42383346 CTCTAAGACAAGTGCTGCAAGGG 0: 1
1: 0
2: 1
3: 8
4: 133
1179587540_1179587549 14 Left 1179587540 21:42383287-42383309 CCACCCTCACTGCCCCTGCTCCC 0: 1
1: 0
2: 14
3: 207
4: 1682
Right 1179587549 21:42383324-42383346 CTCTAAGACAAGTGCTGCAAGGG 0: 1
1: 0
2: 1
3: 8
4: 133
1179587546_1179587549 -6 Left 1179587546 21:42383307-42383329 CCCAGAGCTCACAGCAGCTCTAA 0: 1
1: 0
2: 4
3: 20
4: 227
Right 1179587549 21:42383324-42383346 CTCTAAGACAAGTGCTGCAAGGG 0: 1
1: 0
2: 1
3: 8
4: 133
1179587547_1179587549 -7 Left 1179587547 21:42383308-42383330 CCAGAGCTCACAGCAGCTCTAAG 0: 1
1: 1
2: 3
3: 17
4: 226
Right 1179587549 21:42383324-42383346 CTCTAAGACAAGTGCTGCAAGGG 0: 1
1: 0
2: 1
3: 8
4: 133
1179587538_1179587549 16 Left 1179587538 21:42383285-42383307 CCCCACCCTCACTGCCCCTGCTC 0: 1
1: 1
2: 14
3: 124
4: 975
Right 1179587549 21:42383324-42383346 CTCTAAGACAAGTGCTGCAAGGG 0: 1
1: 0
2: 1
3: 8
4: 133
1179587544_1179587549 1 Left 1179587544 21:42383300-42383322 CCCTGCTCCCAGAGCTCACAGCA 0: 1
1: 0
2: 7
3: 192
4: 483
Right 1179587549 21:42383324-42383346 CTCTAAGACAAGTGCTGCAAGGG 0: 1
1: 0
2: 1
3: 8
4: 133
1179587541_1179587549 11 Left 1179587541 21:42383290-42383312 CCCTCACTGCCCCTGCTCCCAGA 0: 1
1: 0
2: 4
3: 88
4: 599
Right 1179587549 21:42383324-42383346 CTCTAAGACAAGTGCTGCAAGGG 0: 1
1: 0
2: 1
3: 8
4: 133
1179587536_1179587549 29 Left 1179587536 21:42383272-42383294 CCTGCTCCTCTCTCCCCACCCTC 0: 1
1: 2
2: 22
3: 326
4: 2535
Right 1179587549 21:42383324-42383346 CTCTAAGACAAGTGCTGCAAGGG 0: 1
1: 0
2: 1
3: 8
4: 133
1179587537_1179587549 23 Left 1179587537 21:42383278-42383300 CCTCTCTCCCCACCCTCACTGCC 0: 1
1: 3
2: 19
3: 249
4: 2002
Right 1179587549 21:42383324-42383346 CTCTAAGACAAGTGCTGCAAGGG 0: 1
1: 0
2: 1
3: 8
4: 133
1179587543_1179587549 2 Left 1179587543 21:42383299-42383321 CCCCTGCTCCCAGAGCTCACAGC 0: 1
1: 0
2: 7
3: 55
4: 545
Right 1179587549 21:42383324-42383346 CTCTAAGACAAGTGCTGCAAGGG 0: 1
1: 0
2: 1
3: 8
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179587549 Original CRISPR CTCTAAGACAAGTGCTGCAA GGG Intronic
901388125 1:8924559-8924581 CTTTTAGAGAAGGGCTGCAAAGG - Intergenic
901821205 1:11830678-11830700 CTCCAAGACAAGGGCCCCAATGG - Intronic
902988918 1:20172365-20172387 CACTAAGATAGGTGCTGCCAGGG - Intronic
908322424 1:62991341-62991363 CTCTAAAACACCTGCTGCTAAGG + Intergenic
908376444 1:63546734-63546756 GTCAAAGAGAAGTACTGCAAGGG + Intronic
908798857 1:67858253-67858275 CTGAAAGAGAAGTGCTTCAATGG - Intergenic
911666365 1:100557486-100557508 ATCTAAGACCAGTGCAGCACCGG + Intergenic
912165413 1:107037718-107037740 TTCAAAGAAAAGAGCTGCAATGG - Intergenic
914226032 1:145720433-145720455 ATCTCAGACAAGAGCTTCAAGGG + Intronic
916383628 1:164242115-164242137 CTCTATCACAAGAGCAGCAAGGG - Intergenic
922009326 1:221565542-221565564 TTCTAAGGCAAGTTCTGCCAGGG - Intergenic
1063154929 10:3370336-3370358 TTTTCAGACAAGTGCTTCAAAGG - Intergenic
1065131363 10:22623401-22623423 CTCTAAGGCAAGGGTCGCAAGGG + Intronic
1066588267 10:36962345-36962367 CTGTAAAACAAATGCTGCAGAGG + Intergenic
1067658433 10:48215376-48215398 CTATATGCCAGGTGCTGCAATGG - Intronic
1067740600 10:48893129-48893151 CTCAAAGCCAAGGGATGCAAAGG - Intronic
1069760998 10:70811392-70811414 CTCTCAGACAAGCCTTGCAAAGG + Intergenic
1071031407 10:81187464-81187486 CTCTCAGACAACTGCTGAGAAGG - Intergenic
1071923648 10:90379944-90379966 TACTAAGAAAAGTGCTCCAAAGG + Intergenic
1072513894 10:96157735-96157757 CTCACAGTCAGGTGCTGCAAAGG + Exonic
1073615844 10:104994032-104994054 CTCAAAGACATGTGCTGGAAGGG - Intronic
1073891590 10:108109020-108109042 CTCTAAGACAAGGGAAACAAAGG + Intergenic
1074753540 10:116608827-116608849 CTCTAGGACAAGGTCTGCTATGG - Intronic
1075560311 10:123463426-123463448 CTCTAAAACAAGAGTTGCAGGGG - Intergenic
1077020383 11:414599-414621 CTCTGTGACAAGCGTTGCAATGG - Intronic
1077293162 11:1809685-1809707 CGCTGAGACAAGTACTGCCAGGG + Intergenic
1077851495 11:6077900-6077922 CCCGAAGGCAAATGCTGCAAAGG - Intergenic
1078003558 11:7516154-7516176 CCCGAAGGCAACTGCTGCAATGG + Intronic
1078665011 11:13316859-13316881 CTCTAAGACGCCTGCTTCAAAGG + Intronic
1078900621 11:15638977-15638999 CTTTAAAACAATTGCTGAAAAGG - Intergenic
1089009574 11:115121619-115121641 CTCTAGGATAGGTGCTGGAACGG + Intergenic
1091614133 12:2036105-2036127 CTTTTAGACAAGTGCTGCATTGG + Intronic
1094568089 12:31617842-31617864 GTCTAAGAAAAATTCTGCAATGG - Intergenic
1098058825 12:66538494-66538516 CTTGAACACAAGTACTGCAAGGG - Intronic
1106034423 13:26030888-26030910 CGCTGAGACAAGTACTGCCAGGG + Intergenic
1106204906 13:27583821-27583843 CTCTAAGAAAAGTTATGCACAGG + Intronic
1106342391 13:28842919-28842941 CTCTGGGACAGGTGCTGCCATGG + Intronic
1106883998 13:34163002-34163024 ATGTAAAACAAGTACTGCAAGGG - Intergenic
1107824356 13:44314159-44314181 CTCTAAAAGAAGTCCAGCAAAGG + Intergenic
1110277516 13:73656862-73656884 CTGTAAGACAAGTGCTATTATGG - Intergenic
1112394478 13:99016230-99016252 CTCTAAGATGACTGCTGCTATGG + Intronic
1114865719 14:26593934-26593956 TTCTAGGAAAAGAGCTGCAATGG - Intronic
1116369224 14:44108766-44108788 CTTTAACACATGTGCAGCAAGGG + Intergenic
1128996424 15:72299913-72299935 CTCTGAGAAAAGTGTTGCCAAGG + Intronic
1129440897 15:75579957-75579979 CACTAGGGCAAGTGCAGCAAAGG + Intergenic
1130757052 15:86775095-86775117 CTGTCTTACAAGTGCTGCAAGGG - Intronic
1134182707 16:12060741-12060763 CTCAGAGGCAAGTGCTGCAGGGG + Intronic
1137066024 16:35844285-35844307 CTCTCAGGCAAGTGGTGCACAGG - Intergenic
1138873277 16:60918833-60918855 TTCTAAGAAAAGTGCTGAAGTGG - Intergenic
1140672817 16:77295547-77295569 CTTTCTGATAAGTGCTGCAATGG + Intronic
1142249888 16:88986385-88986407 CTCTCAGGCATGTGCTGCAGGGG + Intergenic
1149999124 17:61421528-61421550 CTCTATGGCAGTTGCTGCAAGGG - Intergenic
1152465966 17:80466358-80466380 CTCTCAGACAAGTGCAGGGAAGG + Intergenic
1155682959 18:28512412-28512434 CTCTAAGACAACTGATGGATGGG - Intergenic
1157943050 18:51950167-51950189 ATCTAAGACAAGTACCCCAAAGG - Intergenic
1159064242 18:63551935-63551957 CACTGAGACAAGTGTTGCCAGGG + Intergenic
1159198424 18:65149522-65149544 CACTGAGACAAGTACTGCCAGGG + Intergenic
1160227502 18:77022346-77022368 CTCCAGGACAAGTGCGGAAAAGG + Intronic
1163603002 19:18259880-18259902 CTCTAAGACCTGGGATGCAAGGG + Intronic
1168561658 19:57389726-57389748 CTCTAAGACAAGTCCGGAAGCGG + Intronic
926638090 2:15205714-15205736 CTCTATGACAAGAACAGCAAAGG - Intronic
926982561 2:18586820-18586842 CTCTAAGGCAGCTGCTGAAAAGG + Intronic
927627622 2:24739097-24739119 ATTTTAGATAAGTGCTGCAATGG - Intronic
929554920 2:42920247-42920269 CGCTAAGACCAGAGCTGCAATGG + Intergenic
932077097 2:68674740-68674762 CTCTGTGACAATTGCTGAAATGG - Intergenic
932115319 2:69041646-69041668 CTCTAAGCCAGGTGCTGGACTGG - Intronic
934130756 2:88946522-88946544 CACTAAGACAAGTATTGCCAAGG - Intergenic
937304543 2:120863094-120863116 GTCTAAGCCAAGTCCTCCAATGG - Intronic
941003058 2:160221496-160221518 CTCTCAGTCAAGGGCTGCAAAGG - Intronic
945176692 2:207050746-207050768 CTCAAAGAAAAGTGTTCCAATGG - Intergenic
947925542 2:233918955-233918977 CTCTAAGGAAAATGCTCCAAAGG - Intronic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1170805169 20:19623377-19623399 CTCTGAAACAGGAGCTGCAAAGG + Intronic
1173430961 20:42986922-42986944 CTCTAAGACAGCAACTGCAAAGG - Intronic
1173718438 20:45231482-45231504 CTCTAAGACAAATGCTTCTGAGG - Intergenic
1175039776 20:56037873-56037895 CATTAAGACAAATGCTACAAAGG + Intergenic
1179587549 21:42383324-42383346 CTCTAAGACAAGTGCTGCAAGGG + Intronic
951052855 3:18114006-18114028 CTGTAATACACGTGCTGAAAGGG - Intronic
953384440 3:42498589-42498611 CTCAAGGACAAGTTCTGAAATGG - Intronic
954938781 3:54351950-54351972 CTCTGAGAGAAGTGCTGCAAAGG - Intronic
955132300 3:56182729-56182751 CTCAAAGCCAAGTGGTGAAACGG - Intronic
956853981 3:73257846-73257868 TTCTGTGACAACTGCTGCAAGGG + Intergenic
957217491 3:77340145-77340167 CTATAACACAAGTGCTGCACAGG + Intronic
957711193 3:83861169-83861191 CTCTATCACAAGAGCAGCAAGGG + Intergenic
957862167 3:85967987-85968009 TTCTAAGAAAAATGCTCCAAAGG - Intronic
957897270 3:86438974-86438996 CTCAAAGACTACTACTGCAAAGG - Intergenic
959739847 3:109705384-109705406 CTCTATCACAAGAGCAGCAAGGG + Intergenic
959905107 3:111702685-111702707 CTCTAAGAGAATTGCTGCTTGGG - Intronic
963026795 3:140927695-140927717 GTCAAAGATAAGTGCTGGAAGGG - Intergenic
963074958 3:141337352-141337374 CTCTTAGCAAAGAGCTGCAAAGG + Intronic
964654247 3:159049217-159049239 CTCTAAGACAAGTGCTCAGGAGG + Intronic
966053182 3:175647766-175647788 CACTAATCTAAGTGCTGCAAAGG - Intronic
966221081 3:177551793-177551815 TTTTAAGACAAGTGATACAATGG - Intergenic
967330674 3:188286243-188286265 CTCTGACACAAGTGCTGCTGTGG + Intronic
970337453 4:15063862-15063884 TTCTAAGATATGTGCTACAAAGG + Intronic
976806508 4:89053055-89053077 TTCTAAGTAAAGTGCTGAAATGG - Intronic
976890322 4:90039242-90039264 CTGTTAGACACGTCCTGCAAGGG - Intergenic
978748167 4:112218742-112218764 CACTGAGACAAGTGTTGCCAAGG + Intergenic
980762352 4:137252538-137252560 TTCTAAGAACAGTTCTGCAATGG - Intergenic
983421891 4:167528518-167528540 CTCCAAGGCAAGTTCTACAAAGG - Intergenic
988024344 5:25665796-25665818 CTCTGAAATGAGTGCTGCAAGGG + Intergenic
995020108 5:107357502-107357524 CTCTTAGATAAGTACTTCAATGG - Intergenic
996676251 5:126177996-126178018 CACTAAGACAAGTTGGGCAAAGG + Intergenic
997995494 5:138582576-138582598 CTCTAATTCTTGTGCTGCAATGG + Intergenic
1000718284 5:164674857-164674879 CTCTAAAACAAATGCAGCATTGG + Intergenic
1001178469 5:169495417-169495439 CTCTCAGAGAAGAGCTGGAATGG + Intergenic
1003307806 6:4945393-4945415 CTCTGAGACCAGTGCGGCACTGG - Intronic
1004033216 6:11894108-11894130 CTCAAAGACTATTTCTGCAAAGG - Intergenic
1004613431 6:17267635-17267657 CTCTACGACAAGAACAGCAAGGG + Intergenic
1004691435 6:17995643-17995665 CTCTATAACAAGTGCTACAACGG - Intergenic
1004748304 6:18535158-18535180 CTCTGAGTCAAGTACAGCAATGG - Intergenic
1006446742 6:34084000-34084022 CTCTCAGAGGAGTGCTGGAAAGG - Intronic
1011302528 6:85891786-85891808 ATCAAAGACAAAGGCTGCAAAGG - Intergenic
1011732374 6:90278425-90278447 CACTAAAAAAAGTGCTTCAAAGG - Intronic
1011823664 6:91281479-91281501 CTCTAAGACAATTGAAGAAAAGG - Intergenic
1012857594 6:104520970-104520992 CTCTAAGAAAAGAGCTTCACAGG + Intergenic
1013970179 6:116008545-116008567 CTCTAGGGCAAGTGCTGCTGTGG + Intronic
1016676622 6:146777737-146777759 TTGTCAGAGAAGTGCTGCAAAGG - Intronic
1018625176 6:165771033-165771055 CTCTAAATCCAGTCCTGCAATGG - Intronic
1026407833 7:70086339-70086361 CTCTCAGAAAAGTTCTGCAGTGG + Intronic
1028977182 7:96927012-96927034 GTCTAAAACAAGTGCGGCAAAGG - Intergenic
1031112086 7:117623250-117623272 GTCTAAGAAAAGTGCTCCTACGG + Intronic
1038718723 8:30014159-30014181 ATCTAAGCCGAGGGCTGCAAGGG - Intergenic
1040765333 8:50903114-50903136 CTCTAAAACAAAGGCTGAAAGGG + Intergenic
1043628996 8:82303941-82303963 CTCTAAGAAAAGGGTGGCAAGGG + Intergenic
1044481072 8:92688745-92688767 CTCTAAAAGAAATGCTGCACTGG + Intergenic
1045412710 8:101934596-101934618 CAGTAAGACAAGTACTGAAAGGG + Intronic
1045441706 8:102219949-102219971 TTCTAGGCCAAGTGCTGCAGTGG + Intronic
1046103456 8:109641171-109641193 TTCTAAGTCATGTGCTTCAATGG + Intronic
1046717830 8:117586679-117586701 TTCTGAGAAAAGTGGTGCAATGG + Intergenic
1048361604 8:133701858-133701880 CTCTAAGAGGAGTTTTGCAAAGG + Intergenic
1048902018 8:139048000-139048022 CTCTAAGACAAGTGAACAAATGG + Intergenic
1048984500 8:139727778-139727800 TTCTAACACAGGTGCTGAAATGG - Intergenic
1053152346 9:35751033-35751055 CTCTAAGACAATTTCTGCTTTGG - Intronic
1053275350 9:36779528-36779550 CATTGAGGCAAGTGCTGCAAAGG + Intergenic
1062655564 9:137602998-137603020 CTAGAAGACAAGTGCCACAAAGG - Intergenic
1186733959 X:12441166-12441188 CCCTAAGAGATGTCCTGCAAGGG - Intronic
1187073199 X:15908981-15909003 CCCAAAGACAATTGCTGCTAAGG + Intergenic
1187312263 X:18156484-18156506 CTAGAAGAAGAGTGCTGCAAGGG - Intergenic
1187710724 X:22051109-22051131 CTCTATGACAAGCACTGTAAAGG + Intronic
1192091333 X:68159349-68159371 CTCAAAGACTATTCCTGCAAAGG + Intronic
1192612309 X:72579242-72579264 CTCTGAGAGAAGTGCTGAAAAGG + Exonic
1198806257 X:140498409-140498431 CTCTAAAAGAAGTGGTGCTAGGG + Intergenic