ID: 1179587897

View in Genome Browser
Species Human (GRCh38)
Location 21:42385287-42385309
Sequence GTGTTATCTCAGATGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179587897_1179587900 2 Left 1179587897 21:42385287-42385309 CCACCTTCCATCTGAGATAACAC 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1179587900 21:42385312-42385334 GCATGCCTCTTAAGTCCTTGTGG 0: 1
1: 0
2: 0
3: 2
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179587897 Original CRISPR GTGTTATCTCAGATGGAAGG TGG (reversed) Intronic
903179920 1:21600021-21600043 GTGTCATCTCATCTGGAAGATGG - Intronic
906733356 1:48101916-48101938 GTGGTCACTCAGATGGCAGGGGG + Intergenic
907113275 1:51946986-51947008 TTGTTATATCAGCTTGAAGGAGG + Intronic
907743073 1:57185657-57185679 GTATTAGCGCAGATGGAAGGTGG + Intronic
909073573 1:71026025-71026047 GTGTTATCTCAGATTCTGGGGGG - Intronic
911957976 1:104262124-104262146 ATGTTATTTCAGATGGCACGAGG + Intergenic
913348061 1:117827832-117827854 TTGTTCTCTCTGATGGAAGAAGG + Intergenic
917122326 1:171655470-171655492 GTGTTTCCTCAGAGGGAAAGGGG - Intergenic
918947164 1:191081919-191081941 CTGTTATGTTACATGGAAGGAGG + Intergenic
921589026 1:216982061-216982083 GAGTTTTCTCTGAAGGAAGGAGG - Intronic
923089796 1:230731332-230731354 GTGTGATAACAGATGGAAGGGGG - Intergenic
1066054572 10:31668493-31668515 CTGTTACCTCACATGGAAGAAGG + Intergenic
1066979531 10:42399453-42399475 ATGTTAGCTCAGACTGAAGGTGG - Intergenic
1069791421 10:71024680-71024702 GTGTCATCCCATGTGGAAGGTGG - Intergenic
1070864497 10:79699288-79699310 GTGTTTTCTCAGATGAATGTTGG - Intergenic
1071631397 10:87221518-87221540 GTGTTTTCTCAGATGAATGTTGG - Intergenic
1077058614 11:608015-608037 GTGTGATCTCAGAGGGCAGGAGG - Exonic
1080560757 11:33460257-33460279 GTATTACCTCTGATGGGAGGGGG + Intergenic
1085025001 11:73231185-73231207 ATGTTTACTCAGAAGGAAGGGGG - Intronic
1087134774 11:94705605-94705627 GTGTGATCTCTGTTGGAAGTGGG - Intergenic
1087512463 11:99115009-99115031 GTGTAACCTCACATGGAAGAAGG - Intronic
1087557002 11:99733690-99733712 GTGCTAACTCTGATGGAGGGCGG + Intronic
1087828597 11:102794451-102794473 GGGTCATCTCACATGCAAGGAGG - Intronic
1088970028 11:114765729-114765751 GTGTAATCTCAGAGGATAGGAGG - Intergenic
1089286730 11:117412239-117412261 GTGCTTTCTCAGATGGAAGAAGG - Exonic
1093223129 12:16447456-16447478 GTGTTTTCTCATATGCAAGAAGG + Intronic
1097174118 12:57133064-57133086 GAGGTATTTCAGAAGGAAGGAGG + Intronic
1098172016 12:67756842-67756864 GTCTTAGATAAGATGGAAGGGGG + Intergenic
1100044873 12:90367327-90367349 GAGTTTTCTCAGATGGTAGGTGG + Intergenic
1100265045 12:92967571-92967593 GTGTATCCTCAGCTGGAAGGGGG + Intergenic
1104799529 12:131544241-131544263 GTCTGATCTCAGAGGGCAGGTGG + Intergenic
1107108335 13:36670661-36670683 GTGAAATCTCAGATAAAAGGGGG - Intergenic
1107401186 13:40070800-40070822 GTGTAATCTGAGGAGGAAGGAGG + Intergenic
1108509766 13:51146261-51146283 GTGTTATCTCTGATTGAGGCAGG - Intergenic
1109872322 13:68349410-68349432 GTGTAATTTAAGATGGAATGTGG - Intergenic
1114327909 14:21608026-21608048 GTGTATTCTCAGGTGGAATGTGG + Intergenic
1114455534 14:22851102-22851124 GTGTGAGCTCATTTGGAAGGTGG - Intergenic
1115524909 14:34270378-34270400 GTGGTAGCTCAGAGGTAAGGTGG - Intronic
1116297583 14:43133188-43133210 GTGTTACCTCAGGTGGAAAAGGG + Intergenic
1119320645 14:73728296-73728318 GTTTTATCTCACATTGCAGGAGG - Intronic
1124642788 15:31407001-31407023 ATGTTATCTCACATGGAAAAAGG - Intronic
1127779837 15:62302485-62302507 GTGTAATCTCAGATTGGAGTTGG + Intergenic
1128088647 15:64904157-64904179 TTGTTTTCTCATCTGGAAGGTGG - Intronic
1130889869 15:88124545-88124567 ATGTTTTCTCAGGTGGAAGGAGG + Intronic
1131290106 15:91099995-91100017 GAGATAGCTCAGAGGGAAGGAGG - Intronic
1132465550 16:75875-75897 GTCTTCTCTCTGATGGAGGGGGG - Intronic
1133428153 16:5711417-5711439 GTATTTTCTCAGCTGAAAGGTGG - Intergenic
1133625168 16:7564221-7564243 CTGTGTTCTCAGATGGAAGAGGG - Intronic
1135891242 16:26359360-26359382 TTGTTCTCTAAGATGGAAAGTGG + Intergenic
1136073125 16:27800726-27800748 GTGGCTTCTCAGATGGGAGGTGG + Intronic
1139760329 16:69179825-69179847 GTGTAATTTCATAAGGAAGGAGG - Intronic
1142977458 17:3654318-3654340 GGCTTATCTCTGAGGGAAGGAGG - Intronic
1143998394 17:11029571-11029593 GTGTTATCTCTGCTGAATGGAGG - Intergenic
1144158303 17:12530343-12530365 GAGTCATCTGAGATGGAATGCGG - Intergenic
1145101633 17:20081965-20081987 GTATCATCTGTGATGGAAGGAGG - Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1146722885 17:35135482-35135504 GTGTGGTCTCAGAAAGAAGGAGG + Intronic
1148823600 17:50376065-50376087 GTGCTCTTACAGATGGAAGGTGG + Exonic
1149137795 17:53390744-53390766 ATGTTATCTGAGATGGATGCAGG + Intergenic
1149247279 17:54725266-54725288 ATGTGTTGTCAGATGGAAGGAGG + Intergenic
1150162549 17:62911069-62911091 TAGGTATCTCAGATAGAAGGAGG + Intergenic
1151158558 17:72145134-72145156 AAGGCATCTCAGATGGAAGGAGG - Intergenic
1156243868 18:35278887-35278909 GTGAGATCTCAGATGAAAGGAGG - Intronic
1159303054 18:66601787-66601809 GTGTTCTCTCAATTGAAAGGTGG + Intronic
1160755601 19:755378-755400 ATGTTGTCTCAGATGGGACGAGG + Intronic
1161163824 19:2774943-2774965 GTGTTGTCTCACATGGAGTGGGG + Intronic
1164144617 19:22504420-22504442 ATGATATAGCAGATGGAAGGAGG - Intronic
1164775807 19:30852727-30852749 ATGGTATGTCAGATGGCAGGTGG + Intergenic
1167572958 19:50301607-50301629 GTGGAGTCTCAGAGGGAAGGTGG - Intronic
925095250 2:1193269-1193291 GAGTTTTCTCAGGTGGCAGGTGG + Intronic
925186219 2:1848184-1848206 GTTTTCTCTCAGATGGGAGCTGG + Intronic
925539349 2:4950157-4950179 GTGTCCACTCAGATTGAAGGTGG + Intergenic
925903966 2:8528212-8528234 GGGCAATCTCTGATGGAAGGTGG - Intergenic
928069378 2:28199193-28199215 GTGTAATCCCAGAAGCAAGGTGG + Intronic
928299773 2:30114887-30114909 GCCTTATTTCAGATGGAAGCGGG - Intergenic
928723922 2:34149341-34149363 GTGATATCTCAGATACAAGGAGG + Intergenic
935210732 2:100937902-100937924 ATTAGATCTCAGATGGAAGGTGG + Intronic
935786078 2:106550040-106550062 GTGTTCCCTCAGATGGTAGAAGG - Intergenic
938722669 2:134080197-134080219 ATGTTATGTTACATGGAAGGGGG - Intergenic
942725854 2:179006919-179006941 TTGGTTTCTCACATGGAAGGAGG - Intronic
942954864 2:181762271-181762293 GTTTTCTCTCAGCTAGAAGGAGG + Intergenic
944952734 2:204770784-204770806 GTGTTAATACAGGTGGAAGGTGG - Intronic
945636397 2:212357663-212357685 GTGTTAAAACAGATCGAAGGAGG - Intronic
946706105 2:222460319-222460341 CTGTTATTTCAGATGTGAGGTGG + Intronic
947205200 2:227654469-227654491 GTGAGGTCTCAGATGGAAAGGGG + Intergenic
948005269 2:234603214-234603236 GTTTTATTCTAGATGGAAGGGGG - Intergenic
1169270066 20:4192398-4192420 GTGTCATCTCTGCTGCAAGGAGG - Intergenic
1173306349 20:41854130-41854152 GTGTTTTCTTAGCTGGAAGTAGG + Intergenic
1173437889 20:43048909-43048931 GTGTTACCTGTGATGGAGGGTGG - Intronic
1175533827 20:59693491-59693513 GTGTCATCTCTGATAGATGGGGG - Intronic
1175679678 20:60976865-60976887 TTGTGACCTCAGAAGGAAGGAGG - Intergenic
1176874281 21:14112940-14112962 GGGTTTTCTCACATGGCAGGTGG - Intronic
1177698033 21:24598879-24598901 GTGTTATCTCTCATGGAACAGGG + Intergenic
1178362890 21:31964545-31964567 GTGTTATCTCAGAGGGGTGGAGG + Intronic
1178424760 21:32470564-32470586 GTGTTATCAGAGAGGGAAGATGG - Intronic
1179587897 21:42385287-42385309 GTGTTATCTCAGATGGAAGGTGG - Intronic
1180831954 22:18911073-18911095 GTGAAATCCCAGATGGAATGGGG - Intronic
1182270031 22:29147639-29147661 CTGTTTTCCCAGATGCAAGGAGG - Intronic
1203282032 22_KI270734v1_random:136344-136366 GTGAAATCCCAGATGGAATGGGG - Intergenic
949625607 3:5863302-5863324 GTCAGATCTCAGATGGAAGAGGG + Intergenic
950067297 3:10123259-10123281 CTGTTTTCACAGATGGAATGTGG + Intronic
950385515 3:12656078-12656100 GTCTTATGTAAGTTGGAAGGGGG - Intronic
950552460 3:13675054-13675076 GTGTTGACTCAGGTGGGAGGTGG + Intergenic
950733358 3:14981952-14981974 GTGCTTTCTCAGATTGAGGGTGG + Intronic
953549876 3:43893974-43893996 CTGTTATTTCAGAGGGAGGGAGG + Intergenic
953570385 3:44066910-44066932 TGGTTTTCTCAGAGGGAAGGAGG - Intergenic
956329696 3:68092598-68092620 GATTTACCTGAGATGGAAGGAGG - Intronic
960920253 3:122739372-122739394 GTGTTGTCACAGAGGGAAGGAGG - Intergenic
965940253 3:174170274-174170296 GTGTTATCAAAGATTGTAGGAGG - Intronic
968379073 4:73360-73382 ATGCTATCTCAGACTGAAGGTGG + Intronic
976146796 4:82049961-82049983 GTGTGATCTTAGCTGGGAGGAGG - Intergenic
981046837 4:140272471-140272493 GTGTTATCGAGGATGTAAGGTGG - Intronic
981491556 4:145345928-145345950 GAGTAATCTGAGATGTAAGGAGG + Intergenic
983943062 4:173556709-173556731 GTGTTATGGCAGATCTAAGGAGG + Intergenic
986224647 5:5801456-5801478 GTGTTTTCTCAGCTGGCAGAGGG + Intergenic
987292766 5:16524034-16524056 GGCTGAGCTCAGATGGAAGGCGG - Intronic
988896518 5:35680033-35680055 GTTTTATCTCAGAGGAAAGATGG - Intronic
989456325 5:41648382-41648404 GTGGAATCTCAGAGGGAAGGTGG + Intergenic
990091261 5:52052700-52052722 CTGTGTTCTCACATGGAAGGAGG + Intronic
990429012 5:55716652-55716674 GTCTCATCTCACATGGATGGTGG - Intronic
990568882 5:57057492-57057514 ATGTTATGTTACATGGAAGGGGG + Intergenic
990841362 5:60082972-60082994 GGGCTACCTCAGATGGAGGGAGG - Intronic
991360319 5:65813205-65813227 GTGTTATTTCAGGAGGAAGATGG - Intronic
995945112 5:117635627-117635649 GTGTCAACTCAGGTGGAAGAAGG - Intergenic
999091766 5:148942258-148942280 GAAATATCTCAGATGGAAGATGG + Intronic
1007934492 6:45721066-45721088 GTGTTATCTCACATGGCAAAAGG + Intergenic
1009996050 6:70896187-70896209 GTGTGATCTCAGAGGGAGGGAGG + Intronic
1010927774 6:81764436-81764458 GTCTTATCTCAGATGGCTGTGGG + Intergenic
1011595411 6:89011447-89011469 GTGTTATGTCCCATGGAGGGGGG - Intergenic
1012723498 6:102779826-102779848 GTGTTATCCCAGATTGAGGAAGG + Intergenic
1018614756 6:165676531-165676553 GTGTGAGCCCAGCTGGAAGGTGG + Intronic
1019230001 6:170552566-170552588 GTTTTATTTCAAATAGAAGGTGG - Intronic
1020766721 7:12331271-12331293 GTATCATGTCAGAGGGAAGGAGG - Intronic
1020913089 7:14158237-14158259 GTGTTGTCTCAGATAGAAGAGGG - Intronic
1022159117 7:27691376-27691398 GTCTTCTCTGAGATGGAAGAAGG - Intergenic
1030979845 7:116173618-116173640 GTGTTTGCTCAGATGATAGGAGG - Intergenic
1032676893 7:134138310-134138332 GTAATATCTCAAATGTAAGGAGG - Intronic
1035094586 7:156343144-156343166 GTGGGAGCTCAGATGGCAGGTGG + Intergenic
1035742172 8:1936808-1936830 CTGTCATCTCAGAGGGAAAGTGG + Intronic
1037785763 8:21902191-21902213 GTGGCAGCTCAGATGAAAGGAGG + Intergenic
1041344751 8:56885408-56885430 GTGTTATCTTTGGGGGAAGGTGG + Intergenic
1041869736 8:62619130-62619152 GTGTTTTCACAGATGAAAGCAGG - Intronic
1046205512 8:110990354-110990376 GTGTGAACTCAGGTGGAGGGAGG - Intergenic
1046799725 8:118412682-118412704 GTGGTACCTCAGCTGGTAGGTGG - Intronic
1050125010 9:2347795-2347817 ATGTTATCTCAGTAGGAAGTGGG - Intergenic
1053108850 9:35439087-35439109 GGGTTATTAAAGATGGAAGGAGG - Intergenic
1056014635 9:82370816-82370838 ATATTATCTCAAATGGCAGGTGG - Intergenic
1056201747 9:84283723-84283745 CTCTTATCTCAGATGGAGGTTGG + Intronic
1056233324 9:84568803-84568825 ATGTTATCTTATATGGAAGAAGG + Intergenic
1057287664 9:93773231-93773253 GTGATATTACAGATGGAATGAGG + Intergenic
1059462953 9:114446751-114446773 GAGTTAAGGCAGATGGAAGGAGG - Intronic
1060330452 9:122664049-122664071 GTGTTAACTCAGATTGAGGGTGG + Intergenic
1061530378 9:131207329-131207351 CTGTGATCTCAGCTGGAAGAAGG + Intronic
1188858463 X:35226340-35226362 GTGATATCTGAGGTGGAAGAAGG + Intergenic
1191586711 X:62834726-62834748 GTGAGTTCTCAGATGGAAAGGGG - Intergenic
1192142960 X:68660775-68660797 GGGGTCTCTCAGCTGGAAGGTGG - Intronic
1194757741 X:97757797-97757819 GTGATATCTCAGATACAATGTGG - Intergenic
1196204757 X:112926611-112926633 GTGTCATCTCAAATTGAAGTGGG + Intergenic
1196251056 X:113460465-113460487 GTGAGGGCTCAGATGGAAGGGGG - Intergenic
1197482301 X:127002448-127002470 ATGTTATCTCAGTTGGAGGCAGG - Intergenic
1197918760 X:131565531-131565553 ATGATTTCTCAGATGTAAGGGGG + Intergenic
1201624546 Y:16000058-16000080 ATGTCATCTCAGATGTAAGTGGG - Intergenic
1201863695 Y:18626544-18626566 TTCTTATGTCAGATGGGAGGGGG + Intergenic
1201869627 Y:18693834-18693856 TTCTTATGTCAGATGGGAGGGGG - Intergenic