ID: 1179588429

View in Genome Browser
Species Human (GRCh38)
Location 21:42388914-42388936
Sequence GAGCCATGACCTTACCACAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179588425_1179588429 -2 Left 1179588425 21:42388893-42388915 CCTTCTGTTTCCCCAGGGGAAGA 0: 1
1: 1
2: 4
3: 30
4: 305
Right 1179588429 21:42388914-42388936 GAGCCATGACCTTACCACAGCGG 0: 1
1: 0
2: 1
3: 9
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179588429 Original CRISPR GAGCCATGACCTTACCACAG CGG Exonic
902756965 1:18555441-18555463 GAGCCAGCACCTTTCCACTGGGG + Intergenic
902917545 1:19647760-19647782 GAGCCCTGCCCTTTCCACCGAGG + Intronic
905873904 1:41420070-41420092 GAGCTGTGACCTCACCACATAGG + Intergenic
921007451 1:211108651-211108673 GAGCCAAGACCTTACAAAGGAGG + Intronic
1067728797 10:48794096-48794118 GAGCCATAGCCTTACCACTGTGG + Intronic
1070579738 10:77710491-77710513 AAGCCAGGTACTTACCACAGGGG + Intergenic
1072401835 10:95110871-95110893 CAGCTATGCCCTTCCCACAGAGG + Intergenic
1072763976 10:98081250-98081272 AAGCCATGCCCGCACCACAGAGG + Intergenic
1072895638 10:99364290-99364312 GACCCATGTTCTTATCACAGAGG - Intronic
1073998094 10:109339219-109339241 CAGCTATGCCCTTCCCACAGAGG + Intergenic
1077380097 11:2229395-2229417 GGTCCATGACCTTTCCACAGAGG + Intergenic
1078925353 11:15869907-15869929 TAGCCATGACCCTTCCACTGTGG - Intergenic
1081955986 11:47093712-47093734 TTGCCATGACCTTACTACTGGGG - Intronic
1084190324 11:67495697-67495719 CAGCCAGGACCTGACCAGAGGGG - Intronic
1084403804 11:68959828-68959850 GAGACATGCCCTAACCCCAGTGG - Intergenic
1085419906 11:76347544-76347566 CTGCCAAGACATTACCACAGAGG - Intergenic
1088851390 11:113706207-113706229 GAGACGTAACCTTACCATAGGGG + Exonic
1094553360 12:31473220-31473242 GAGCCATTGCCTCAACACAGTGG + Intronic
1100245695 12:92754354-92754376 GAGCCATGACCTCAAATCAGTGG - Intronic
1106348025 13:28898432-28898454 GAGCCCTGCTCTTTCCACAGTGG + Intronic
1107106641 13:36650244-36650266 GAGCCAATACCTTAGGACAGTGG + Intergenic
1110035527 13:70677591-70677613 AAGCAATGAAGTTACCACAGAGG - Intergenic
1116792766 14:49357125-49357147 CAGCTATGCCCTTCCCACAGAGG - Intergenic
1119572766 14:75690671-75690693 GAGCCATGATCGTGCCACTGTGG - Intronic
1124100092 15:26684816-26684838 GATCCTTGATCTTACCACTGTGG - Intronic
1127982440 15:64045171-64045193 CAGCCAGGAACTTACCCCAGAGG + Intronic
1128523434 15:68390612-68390634 AAGCCAGGTCCATACCACAGAGG + Intronic
1129711139 15:77820661-77820683 AAGCCATGCCCTTCCCAAAGGGG - Intronic
1130678326 15:85973990-85974012 GAGTCATGTCCTGACCACAAGGG - Intergenic
1131286544 15:91063763-91063785 AAGCCAGGAGCTTCCCACAGTGG - Intergenic
1132951760 16:2566779-2566801 GAGCCAGGAGCTGACCACACCGG - Intronic
1132962590 16:2633391-2633413 GAGCCAGGAGCTGACCACACCGG + Intergenic
1134026909 16:10961352-10961374 GGCCCATGACCTCACCACTGTGG + Intronic
1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG + Intronic
1139968144 16:70756849-70756871 GAGTCATGGCCGTGCCACAGTGG + Intronic
1141340707 16:83201492-83201514 TCGCCAGGACCTTACCACATGGG - Intronic
1141512506 16:84521775-84521797 GAGCCATGATCACACCACTGCGG - Intronic
1141878973 16:86845563-86845585 CAGGCAGGGCCTTACCACAGGGG - Intergenic
1144750309 17:17644037-17644059 GAGCCATGTCCTTATCAAAAGGG + Intergenic
1144811013 17:17998982-17999004 GAGACATGACCTGTCCAGAGGGG - Intronic
1146312576 17:31780467-31780489 AAGCCATGACCTTAACCCAGGGG - Intergenic
1147169556 17:38609948-38609970 GAGCCACTGCCCTACCACAGGGG - Intergenic
1147476036 17:40712291-40712313 AAGCCCTGTCCTTCCCACAGTGG + Intergenic
1147690365 17:42311285-42311307 CGGCCATGTCCTTAGCACAGGGG + Exonic
1148656847 17:49290632-49290654 AAGCCAGGACCTTCCCATAGGGG - Intronic
1156985323 18:43344182-43344204 AAGGCATGACCTTTCCAGAGGGG - Intergenic
1159084766 18:63776120-63776142 GCGCCATGACCCTATCCCAGAGG + Intronic
1159340230 18:67125025-67125047 GAGCCATGACCTAACAACAGAGG - Intergenic
1160967322 19:1752514-1752536 CAGCCCTGACCTTACCCCACTGG + Exonic
1164556252 19:29255092-29255114 CAGCTATGCCCTTCCCACAGAGG + Intergenic
1166699106 19:44871893-44871915 CAGCCAGGACCCTACGACAGTGG + Exonic
925596894 2:5564036-5564058 TAGCCATGAGCTATCCACAGAGG - Intergenic
928742188 2:34368466-34368488 GGGCCATAAGCTAACCACAGGGG - Intergenic
929025715 2:37599776-37599798 CAGCTATGCCCTGACCACAGAGG + Intergenic
929068220 2:38001907-38001929 GAGCCTTGACCATCCTACAGTGG - Intronic
940662474 2:156564276-156564298 CAGCCATGAGGTAACCACAGGGG - Intronic
941504267 2:166321467-166321489 GAGCCATGATCACACCACTGCGG + Intronic
946517539 2:220429658-220429680 GAGCCATGGCTTTATCACTGTGG + Intergenic
947562455 2:231168856-231168878 GTCCCATGACCTTGCCACTGAGG - Intronic
948172084 2:235911893-235911915 GAGGTATGACCTTAGCACAGAGG + Intronic
948772109 2:240256869-240256891 GAGCCATGGATTTGCCACAGGGG - Intergenic
1172188501 20:33047585-33047607 GAGCCAAGACCTGACCAGAAAGG - Intergenic
1173083762 20:39894905-39894927 GATCCAGGACCTGACAACAGAGG + Intergenic
1174185205 20:48701609-48701631 GGGCCCTGTCCTTACCAAAGGGG - Intronic
1177729061 21:25004945-25004967 GAGACAAGACCTTAACAGAGGGG + Intergenic
1179588429 21:42388914-42388936 GAGCCATGACCTTACCACAGCGG + Exonic
1181152649 22:20896208-20896230 GAGCCATGACCATGCCACTTGGG + Intergenic
1182700452 22:32232995-32233017 GAGACATGTCCTTGCCACACAGG + Exonic
1182933844 22:34201230-34201252 CAGCCATGTCCTCACCACACTGG - Intergenic
1185363808 22:50425573-50425595 GAGGCCAGACCTTTCCACAGTGG + Intronic
949369202 3:3316766-3316788 GGGCCATGAGCATATCACAGAGG - Intergenic
953536738 3:43782637-43782659 GAACCATAACCCTACCTCAGAGG - Intergenic
965845672 3:172958524-172958546 CAGCCATGACCTTAGAACTGAGG - Intronic
967095580 3:186174830-186174852 GTGCCATGCCCTTGCCACACTGG + Intronic
969299840 4:6291422-6291444 GAGCCAGGACCTTCCCATAGGGG + Intronic
974723489 4:65771716-65771738 CAGCCATGCCCTTCCCCCAGAGG + Intergenic
976367063 4:84244352-84244374 GACCCATGACCCTAACAAAGAGG + Intergenic
985539060 5:479407-479429 GAGCCATGGCCGGCCCACAGCGG + Intronic
991575874 5:68102758-68102780 CAGCTATGCCCTGACCACAGAGG - Intergenic
992217927 5:74543857-74543879 GAGCCATTTCCTGACCCCAGAGG + Intergenic
995767906 5:115638861-115638883 GACCAATGAGCTTAGCACAGTGG + Intergenic
996765323 5:127030220-127030242 CAGCCCTGACCTCCCCACAGCGG + Intronic
1002215439 5:177628910-177628932 GAGCCATGATCATGCCACTGTGG - Intergenic
1002863159 6:1097561-1097583 GAAGCATGCCCTTACCCCAGAGG - Intergenic
1003226146 6:4207703-4207725 GATCCATGACCTCCCCATAGAGG - Intergenic
1005360537 6:25027413-25027435 GGGCCCTGACCCTCCCACAGAGG - Intronic
1006210234 6:32387146-32387168 GAGACATTACTTTACCACAGGGG + Intergenic
1007214036 6:40222148-40222170 GAGCCATGACCACACCATTGTGG - Intergenic
1010100417 6:72099030-72099052 GAACAATGTCCTTACCACATGGG - Intronic
1014826579 6:126054124-126054146 GAGCCTTGGCATTACCAAAGGGG - Intergenic
1016615305 6:146041269-146041291 GAGCCATAACCTTCCCAAATGGG - Intronic
1021912027 7:25396071-25396093 GAGCAATGCCCTTTCCAAAGAGG + Intergenic
1024294819 7:47833529-47833551 GAGGCATGACCCTGCCACAGAGG + Intronic
1025763619 7:64418874-64418896 AAGCCCTGACCTCACCACTGTGG - Intergenic
1025929530 7:65982663-65982685 GAGCCCTGACCTTAACCCAGGGG + Intergenic
1028140013 7:87263432-87263454 CAGCTATGTCCTGACCACAGAGG + Intergenic
1033956417 7:146854242-146854264 TAGCCATGACCCTTCAACAGAGG - Intronic
1033990548 7:147280126-147280148 GAGCCAAGACATTACCAGAGTGG + Intronic
1034040074 7:147868556-147868578 GAGCTATGCCCTGCCCACAGAGG + Intronic
1034546651 7:151793953-151793975 GAGCCATTTACTTTCCACAGAGG + Intronic
1035250706 7:157595321-157595343 GAGACAAGACCACACCACAGCGG + Intronic
1035458475 7:159024439-159024461 CAGCCATGACCTCCTCACAGTGG - Intergenic
1042689962 8:71486660-71486682 GAGCCAAGACCTGACAGCAGGGG + Intronic
1046104683 8:109651236-109651258 GAGAAATGACCTTAACTCAGAGG + Intronic
1046879199 8:119289906-119289928 CAGCTATGCCCTTCCCACAGAGG + Intergenic
1046994948 8:120508841-120508863 GATCCATTACATTACAACAGTGG + Intronic
1047004523 8:120605928-120605950 GAGCCATGACCCTGCCAAGGTGG + Intronic
1049142243 8:140965483-140965505 GAGACATGACCCTACCCCAAAGG + Intronic
1049220010 8:141424860-141424882 GGGCCATGACCCTGCCCCAGGGG + Intronic
1051343716 9:16133854-16133876 GATCCATGTCCCTGCCACAGTGG + Intergenic
1053449333 9:38180072-38180094 GTACCTTGCCCTTACCACAGGGG + Intergenic
1056142907 9:83700877-83700899 GAGCCATTAGCTTTACACAGAGG + Intronic
1056547895 9:87628057-87628079 GAGCCATGTTCTTCCCATAGGGG + Intronic
1059184384 9:112254042-112254064 GAGCCATGATTGTACCATAGTGG - Intronic
1059855584 9:118393613-118393635 GTAACATGACCTCACCACAGAGG + Intergenic
1060779274 9:126399686-126399708 GAGCCATTCCCTTATCACACTGG - Intronic
1197235222 X:124054808-124054830 GAGCCATGATCATACCACCTGGG - Intronic
1200136593 X:153878180-153878202 CAGCCAGGACCTTATCAAAGCGG + Intronic