ID: 1179588481

View in Genome Browser
Species Human (GRCh38)
Location 21:42389264-42389286
Sequence GGCCCAGGAACCACAGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 1, 2: 5, 3: 34, 4: 324}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179588474_1179588481 3 Left 1179588474 21:42389238-42389260 CCCCACTTTATCTCGCTATGTGG 0: 1
1: 0
2: 0
3: 13
4: 69
Right 1179588481 21:42389264-42389286 GGCCCAGGAACCACAGTGCAAGG 0: 1
1: 1
2: 5
3: 34
4: 324
1179588476_1179588481 2 Left 1179588476 21:42389239-42389261 CCCACTTTATCTCGCTATGTGGC 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1179588481 21:42389264-42389286 GGCCCAGGAACCACAGTGCAAGG 0: 1
1: 1
2: 5
3: 34
4: 324
1179588473_1179588481 24 Left 1179588473 21:42389217-42389239 CCAAGGGGTGGGGCTGCTGTGCC 0: 1
1: 0
2: 4
3: 59
4: 651
Right 1179588481 21:42389264-42389286 GGCCCAGGAACCACAGTGCAAGG 0: 1
1: 1
2: 5
3: 34
4: 324
1179588477_1179588481 1 Left 1179588477 21:42389240-42389262 CCACTTTATCTCGCTATGTGGCC 0: 1
1: 0
2: 0
3: 16
4: 81
Right 1179588481 21:42389264-42389286 GGCCCAGGAACCACAGTGCAAGG 0: 1
1: 1
2: 5
3: 34
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179588481 Original CRISPR GGCCCAGGAACCACAGTGCA AGG Intronic
901320106 1:8334835-8334857 GGCTCAAGAACAACATTGCATGG - Intronic
901547485 1:9969492-9969514 CGCCCATGAACCACTGTGCCTGG - Intronic
903679120 1:25085273-25085295 GCCCCAGGGACCTCACTGCATGG + Intergenic
904894661 1:33805429-33805451 GTGCCTGGAACCACAGTGCTGGG - Intronic
905028216 1:34865577-34865599 GGCCCAGGGACCACAGTGGCTGG - Exonic
905306963 1:37026337-37026359 GGCCCACCAACTCCAGTGCAGGG + Intronic
905348858 1:37330633-37330655 GTCCCAGGAATCACAGTGCCTGG + Intergenic
905879777 1:41455947-41455969 GTCCCAGGAGCCCCAGGGCAGGG + Intergenic
907848186 1:58228697-58228719 GGTCCAAGAACCCCAGGGCAAGG - Intronic
909267294 1:73577063-73577085 TTCCCTGAAACCACAGTGCAGGG + Intergenic
909519092 1:76546692-76546714 GGCCCAGGAGGCACAGTGGTTGG + Intronic
911181669 1:94866314-94866336 GGCCCAAGGACCTCAGTGGAAGG + Intronic
912759463 1:112354226-112354248 GGCACAGGAACTAAAGTGAAAGG - Intergenic
914332953 1:146689380-146689402 CACCCAGGAACCACAATGGAAGG + Intergenic
914750565 1:150532249-150532271 GACCCAGGAACGAAAGCGCAGGG + Intergenic
915624580 1:157106871-157106893 GGCACAGGGACCAGGGTGCATGG - Intergenic
915945866 1:160151565-160151587 GCCCCAGCAACCACAGGGCCTGG + Exonic
917093938 1:171381712-171381734 GGACCAGGCACCACGGAGCAGGG + Intergenic
920318560 1:205098543-205098565 GGCCTATGAACCACTGTGCCTGG - Intronic
920690902 1:208145599-208145621 GTCCCAGGGACCACAGAGGAAGG - Intronic
920910886 1:210215201-210215223 GGCCCTGGAAAAACACTGCAAGG - Intergenic
921094352 1:211874292-211874314 GGACTAGGAGCCACAGAGCAGGG + Intergenic
922800567 1:228362893-228362915 TGCCCAGGACCCCCAGTGCATGG - Intronic
923105050 1:230847999-230848021 AGCCCAGGAACCACTGTGACTGG - Intronic
924034741 1:239924793-239924815 GGACCAGGCACCACGGAGCAGGG + Intergenic
1063386688 10:5620379-5620401 GTCCCAGGATCCACAGAGGAAGG + Intergenic
1064205586 10:13321121-13321143 GGGCAAGGGACCACAGTGCTGGG - Intronic
1064449948 10:15432767-15432789 GGAGCAGGATCCAGAGTGCACGG - Intergenic
1064464156 10:15562761-15562783 GTCCCAGGGCCCACAGTGCTGGG - Intronic
1065102034 10:22340809-22340831 GGCCCGGGAAGCAAAGTGAAAGG + Intergenic
1065122704 10:22544355-22544377 GGCCTTGGAACAACAGGGCAGGG - Intronic
1067183504 10:44007753-44007775 AGCCCAGAAACCACACGGCAGGG - Intergenic
1068211382 10:53924511-53924533 GGACCAGGTGCCACAGAGCAGGG - Intronic
1069706610 10:70462696-70462718 GGCACAGGAGGCACAGTGCCAGG - Intergenic
1069983912 10:72271033-72271055 CTCCCAGGAGCCAGAGTGCAGGG - Intergenic
1070707083 10:78647614-78647636 TGCCCATGAACCACACTGCGAGG - Intergenic
1070832170 10:79424782-79424804 GGCCCAGGGCTCACAGTGCCCGG + Intronic
1071194500 10:83142188-83142210 GGCACAGGAATCACAGAGGAGGG - Intergenic
1071440584 10:85688876-85688898 TGCTCAGGAACCACAGAGAATGG + Intronic
1071796405 10:89011156-89011178 TTCCCAGGAAACACATTGCAGGG + Intronic
1072985433 10:100135463-100135485 GGGCCAGGATCCAAAGTACAGGG + Intergenic
1074919729 10:117994917-117994939 TGCTGGGGAACCACAGTGCAAGG - Intergenic
1075626433 10:123967446-123967468 GGACCAGGACCCAGAGTGGAGGG + Intergenic
1076311823 10:129513532-129513554 GGCCCAGAATCCACAGTGCCAGG + Intronic
1076693765 10:132237199-132237221 AGCCCAGGGAGCACAGTCCAGGG - Intronic
1077330169 11:1980688-1980710 GGCCCAGGGACCCCAGGACAGGG - Intronic
1077456877 11:2686630-2686652 GGCCCAGGCTGCACAGAGCATGG + Intronic
1078563821 11:12396433-12396455 GGCCCTGGAAGCAAAGTGCCTGG + Intronic
1078664901 11:13316191-13316213 GCCACAGAAACCACAGTCCAGGG - Intronic
1079689759 11:23405073-23405095 GGCCCAGGGACCACAGTGGGAGG - Intergenic
1080276785 11:30512199-30512221 GACCCTGGAACCAAGGTGCATGG - Intronic
1080642903 11:34168120-34168142 AGCCCAGGAAGCACAGAGCCTGG - Intronic
1081667295 11:44923954-44923976 GGCCCAGGTGCCACACAGCAGGG + Intronic
1081747751 11:45484856-45484878 GGCCCTGGAGCCAGAGTGCCTGG - Intergenic
1082255424 11:50028170-50028192 GGAACAGGAAACACAGTGAAGGG - Intergenic
1082874516 11:57974280-57974302 GGTCCACTAACCACAGTGTATGG + Intergenic
1082880051 11:58028243-58028265 GACCTAGGAACCACGGTGGAGGG - Intronic
1083280264 11:61622482-61622504 GGCCCAAGCACCACTCTGCATGG - Intergenic
1083618827 11:64039102-64039124 GGGCCAGGTACCAGAGTGGATGG - Intronic
1083732477 11:64660302-64660324 GGGTCAGGAAGCACAGGGCAGGG + Intronic
1084269314 11:68020698-68020720 AGCCCAGGAAGCACTGTGCCAGG + Intronic
1084368050 11:68716566-68716588 GCCCCAGGAGTCACAGGGCATGG - Intronic
1084393005 11:68890852-68890874 GGGGCAGGGATCACAGTGCAGGG - Intergenic
1084489121 11:69468831-69468853 CCCACAGGAACCTCAGTGCAAGG + Intergenic
1084571237 11:69961174-69961196 GGGGCAGGGAGCACAGTGCAGGG + Intergenic
1087023052 11:93622401-93622423 AGCCCAGCAACCACACTGTAAGG + Intergenic
1089844081 11:121444729-121444751 GGAGCAGGAACCACACTCCATGG + Intergenic
1090420130 11:126569009-126569031 GGCCAAGGAACCAGAGAGCTTGG + Intronic
1090719818 11:129460934-129460956 GGCCCTGGAACACCAGTGCGTGG + Intergenic
1091085617 11:132719091-132719113 GGCCCAGGAAGCAGGGTGGAGGG + Intronic
1202813146 11_KI270721v1_random:35867-35889 GGCCCAGGGACCCCAGGACAGGG - Intergenic
1091705144 12:2688628-2688650 AGCCCAGGAGCCGCAGTGGATGG - Exonic
1094443459 12:30504820-30504842 GGCCAAGCAATCACAGTGGAAGG - Intergenic
1097974318 12:65668140-65668162 GGCCCAGGAAGCAGAGTGGAGGG + Intergenic
1100472398 12:94905230-94905252 GGCCCAGGAGCCAGAGTGCATGG - Intronic
1101235550 12:102785618-102785640 GGTCCAGGAACCACATGGAAGGG + Intergenic
1101445154 12:104732165-104732187 GGCCCAGCCACCACAGGGCATGG - Intronic
1101575232 12:105991097-105991119 GGCCCAAGAGCAAGAGTGCAGGG + Intergenic
1102445663 12:113000428-113000450 GGCCCAGGAACCACTGCATAAGG + Intronic
1102907495 12:116688040-116688062 TGCCCAGGAGACTCAGTGCAGGG + Intergenic
1103381448 12:120496830-120496852 GGCGCAGGAACCACACAGAAGGG - Intronic
1104499953 12:129275595-129275617 AGCCCAGACACCACAGTTCAGGG + Intronic
1104881858 12:132077349-132077371 TGCCCAGGAAACTCAGTCCAGGG - Intronic
1105014394 12:132777352-132777374 GGCCCCGAGACCACAGTGCATGG + Intronic
1105453609 13:20521360-20521382 GGCACAGGGACCAGATTGCACGG + Intronic
1105784691 13:23736919-23736941 GGCTCAGGAACCAGACTGCCAGG - Intronic
1105829420 13:24150659-24150681 GGTCCAGAATCCACAGGGCAAGG + Intronic
1106229329 13:27809682-27809704 GGCCCAGGAACCGGAGTGTGAGG + Intergenic
1106477133 13:30108496-30108518 GACCCAGGAAACACGGTGGAGGG - Intergenic
1107382241 13:39869172-39869194 GGCAGAGAAAGCACAGTGCAGGG + Intergenic
1110064588 13:71087576-71087598 GGACCAGGCGCCACAGAGCAGGG - Intergenic
1112549842 13:100409242-100409264 GGCTTAGGAGCCACAGTGAAAGG + Intronic
1113454415 13:110438061-110438083 AGCCCAGGAGCCACAGGGGAGGG - Intronic
1113766147 13:112882176-112882198 GGCTCAACAACCACAGTGCTGGG - Exonic
1113909266 13:113834504-113834526 GCCCCCGGAACCACCGTGAAGGG + Intronic
1113967499 13:114162399-114162421 GGCTCAGGAACCAGAGCTCACGG + Intergenic
1114629501 14:24150159-24150181 GGCACAGGCAGCACAGTGCCAGG - Exonic
1117020998 14:51570111-51570133 GGCCCATGAGCCACCGTGCCCGG + Intronic
1119380622 14:74225945-74225967 GACCCAGCACCCACAGTGCGCGG + Intergenic
1119669563 14:76508198-76508220 GGTCCAGGAAGCACAGTGTGGGG - Intergenic
1119765897 14:77187495-77187517 GGCCCAGGCTCCACACTCCATGG + Intronic
1120214615 14:81668742-81668764 GGACCAGGCACCACAGAGCAAGG + Intergenic
1122269805 14:100563770-100563792 GGCCCAGGCTGCACAGTGCCCGG + Intronic
1122297914 14:100715639-100715661 AGACCAGGAACCACAGAGGATGG + Intergenic
1122479746 14:102039327-102039349 GGCCAAGGAGCTACTGTGCAGGG - Intronic
1122544810 14:102516636-102516658 GGCCCAGGTCGCACAGTGCAGGG + Intergenic
1122740637 14:103869822-103869844 GGGACAGGAACCCCAGTGAATGG - Intergenic
1122855714 14:104559249-104559271 GGCCTTGGGACCACCGTGCAAGG + Intronic
1123060324 14:105591507-105591529 GACTCCGGAACCACAGGGCAGGG - Intergenic
1123084801 14:105712478-105712500 GACTCCGGAACCACAGGGCAGGG - Intergenic
1127453478 15:59138276-59138298 GCCTCAGGTGCCACAGTGCAAGG - Exonic
1129270164 15:74415309-74415331 CACCCAGGAGCCACAGAGCAGGG + Intronic
1129333443 15:74839254-74839276 GGCCTGGGACTCACAGTGCAGGG + Exonic
1129739246 15:77982002-77982024 GGTCCAGGGCCCACAGTGCCAGG - Intergenic
1130126130 15:81095578-81095600 GGCACCAGAACCACTGTGCAGGG - Intronic
1130255191 15:82322704-82322726 GGTCCAGGGCCCACAGTGCCAGG - Intergenic
1130599783 15:85267302-85267324 GGTCCAGGGCCCACAGTGCCAGG + Intergenic
1132982047 16:2743237-2743259 GGCCCAGGGTGCACAGAGCAGGG + Intergenic
1133025409 16:2987060-2987082 GGCACAGGGACCTCAGTGCTGGG + Intergenic
1135482503 16:22832756-22832778 GGGCCATGAGCCACAGTGGAAGG + Intronic
1136570033 16:31091148-31091170 GGTCCAAGAACCCCAGGGCAAGG - Exonic
1137641898 16:50039461-50039483 GGCCCCAGAACTACAGTTCAGGG + Intergenic
1138456915 16:57126372-57126394 GGCCCAGGAACCAGAATGGCTGG - Intronic
1139653044 16:68372116-68372138 GGCCCAGGACACACAGTGCAGGG + Exonic
1140000665 16:71021864-71021886 CACCCAGGAACCACAGTGGAAGG - Intronic
1140881539 16:79202505-79202527 GGCCCGGGAACAACAGTGGAAGG - Intronic
1141659930 16:85436342-85436364 GGGCCAGGATCCACAGTGGCCGG - Intergenic
1142227064 16:88882749-88882771 GACCCAGGCACCACTGTGGATGG + Exonic
1143178658 17:4970812-4970834 GGCCCAGGTAGGACAGTGGATGG - Intronic
1143335079 17:6166022-6166044 GCCCCAGGAGCCAGTGTGCAGGG - Intergenic
1144564627 17:16349706-16349728 GGCCCAGGTGACACAGAGCAGGG - Intronic
1144876050 17:18397982-18398004 GGCCCAGGAACCTCACTGCCGGG - Intergenic
1145156178 17:20546438-20546460 GGCCCAGGAACCTCACTGCCGGG + Intergenic
1145176774 17:20707414-20707436 GGACCAGGTAGCACAGTGCTTGG + Intergenic
1145250362 17:21293895-21293917 GGCCCCAGAACCTCAGGGCAAGG + Intronic
1145761077 17:27425769-27425791 GGCCCAGCTCCCACAGAGCAGGG + Intergenic
1146843649 17:36170523-36170545 GGCCCGGGAACCTCACTGCCGGG + Intronic
1146855956 17:36258461-36258483 GGCCCGGGAACCTCACTGCCGGG + Intronic
1146864664 17:36329914-36329936 GGCCCGGGAACCTCACTGCCGGG - Intronic
1146865062 17:36331574-36331596 GGCCCAGCTCCCACAGAGCAGGG + Intronic
1146871465 17:36380712-36380734 GGCCCAGCTCCCACAGAGCAGGG - Intronic
1146871862 17:36382372-36382394 GGCCCGGGAACCTCACTGCCGGG + Intronic
1146879223 17:36433454-36433476 GGCCCGGGAACCTCACTGCCGGG + Intronic
1146883156 17:36454600-36454622 GGCCCGGGAACCTCACTGCCGGG + Intergenic
1147067526 17:37930508-37930530 GGCCCGGGAACCTCACTGCCGGG - Intronic
1147074748 17:37982996-37983018 GGCCCGGGAACCTCACTGCCGGG + Intronic
1147079055 17:38010063-38010085 GGCCCGGGAACCTCACTGCCGGG - Intronic
1147086271 17:38062535-38062557 GGCCCGGGAACCTCACTGCCGGG + Intronic
1147094994 17:38134005-38134027 GGCCCGGGAACCTCACTGCCGGG - Intergenic
1147102217 17:38186500-38186522 GGCCCGGGAACCTCACTGCCGGG + Intergenic
1147566463 17:41539275-41539297 CACCAAGGAACCACAGTGCCAGG + Intergenic
1147882854 17:43665275-43665297 GGCCCAGGGACCTCATGGCAGGG + Intergenic
1149846803 17:60013011-60013033 GGCCCGGGAACCTCACTGCCGGG + Intergenic
1150085153 17:62269585-62269607 GGCCCGGGAACCTCACTGCCGGG + Intergenic
1150134442 17:62688303-62688325 GGGCCAGGAACCCCAGAGCCGGG + Exonic
1150645962 17:66977637-66977659 GGCCCAGGCACCACGGGGCAGGG + Intronic
1151279691 17:73064231-73064253 GGGCCATGAGCCACAGTGCTTGG - Intronic
1151674277 17:75589697-75589719 TCCCCAGGATCCACAGGGCAGGG + Intergenic
1151758303 17:76087160-76087182 GGCCCAGGGACCTCAGTGCTTGG + Intronic
1151840588 17:76614945-76614967 GGACCGGGCACCACAGAGCATGG + Intergenic
1152364277 17:79845895-79845917 GGCCCAGGAGGCTCCGTGCAGGG + Intergenic
1152458374 17:80428758-80428780 GGCTCAGGACAGACAGTGCAGGG + Intronic
1152700231 17:81814989-81815011 GGCCCAGGGACCACACAGCGGGG + Intergenic
1153096645 18:1413974-1413996 GGCCCAGGTACCACAGTGTCAGG - Intergenic
1154292769 18:13124555-13124577 GTCCCAGGCAGCACAGTGCCTGG - Intronic
1155168187 18:23247886-23247908 GGCCCAGGGAGCCCAGTGCTTGG - Intronic
1157815580 18:50727543-50727565 GCCGCAGGAACCACAGTCAAGGG - Intronic
1158443966 18:57502627-57502649 ATCCTAGGAAGCACAGTGCAGGG + Intergenic
1158672909 18:59492837-59492859 GCCCCAGTAACAACTGTGCATGG + Intronic
1160004829 18:75062007-75062029 AGCCCAGGTACCTTAGTGCAGGG + Intronic
1160448741 18:78947441-78947463 GCCCCAGCAACCTCAGGGCAGGG - Intergenic
1160534793 18:79586071-79586093 GGCACAGCAACCAGAGTGCAGGG - Intergenic
1160799147 19:959792-959814 GGCCCGGGAACCCCAGATCAAGG - Intronic
1160823649 19:1069426-1069448 CTCCCAGAAACCACAGTGCCAGG + Intronic
1160843324 19:1156019-1156041 GGCCCAGGCCCCACGGTGGACGG + Intronic
1161196105 19:2987538-2987560 AGCCCAGGACCCACAGCCCAGGG + Intronic
1161570864 19:5030329-5030351 GGCCCAGGAAGGACAGGGCCTGG - Intronic
1161572119 19:5036395-5036417 GGCCCAGCAACTCCAGTGGAAGG - Intronic
1162869771 19:13576992-13577014 GGCTCAGGAGCCACAGTGCCTGG - Intronic
1163080877 19:14941260-14941282 GTTCCAGGAACCACAGTTTAAGG + Intergenic
1164484513 19:28643369-28643391 AGCCCTGGAATCACAGTGAAGGG + Intergenic
1164917742 19:32065673-32065695 GGCCCAGGAACCTCAGAGGAAGG + Intergenic
1165126774 19:33603668-33603690 GGCCCAGAGACCAGAGTGTAGGG + Intergenic
1165740586 19:38203060-38203082 TGCCCATGAAGTACAGTGCACGG - Intronic
1165896240 19:39142848-39142870 GGCCCAGTCACCACAGCCCAAGG - Intronic
1166645847 19:44531111-44531133 GGCTCTGGAGCCAGAGTGCATGG + Intergenic
1167730030 19:51247160-51247182 GGTCCAGGAACAAGGGTGCATGG + Intronic
1167876391 19:52417213-52417235 TTCCCAGGGACCACAGTGAATGG - Exonic
926045886 2:9709389-9709411 GGCCCAGGTTACTCAGTGCAGGG + Intergenic
927490959 2:23520554-23520576 GGCCCAGGAAACAGAGGTCAGGG - Intronic
931965180 2:67524948-67524970 GGCTCATGAATCACTGTGCAAGG - Intergenic
932659668 2:73641394-73641416 TGGCAAGGAACCACAGGGCAGGG + Exonic
932732716 2:74232333-74232355 GGCCCAAGAACCACAGGGACAGG - Intronic
933490992 2:82985735-82985757 GGACCAGGCACCACAGAGCAGGG + Intergenic
933733803 2:85478845-85478867 GGCCCAGAAATTACAGTGCTGGG - Intergenic
933950945 2:87329123-87329145 GAACAAGGAACCACAGTTCATGG + Intergenic
934927800 2:98393779-98393801 GGCACAGGAATCACACTCCAAGG + Intronic
936328831 2:111529455-111529477 GAACAAGGAACCACAGTTCATGG - Intergenic
936839670 2:116754427-116754449 GGCCCCGGAACGACAGGGCTGGG - Intergenic
937362094 2:121236642-121236664 GGCCCTGGAAGAACAGTGGAAGG - Intronic
937378700 2:121356159-121356181 GGTCCAGGAACAACAGTGGCTGG + Intronic
938121952 2:128640274-128640296 GACCCAGAGACCCCAGTGCAGGG + Intergenic
939300475 2:140331049-140331071 GGCCCAGCAACCCCATTGCTGGG + Intronic
939673678 2:145045272-145045294 GGCCCAGGAACCAGAGCACCTGG - Intergenic
943260044 2:185647979-185648001 GGCACAGGCATCACAATGCAAGG + Intergenic
944082634 2:195805754-195805776 GGCACAGGAGGCACAGTGCTTGG - Intronic
946326940 2:218989494-218989516 GGCCCAGGTACCATCATGCAGGG - Intergenic
946750256 2:222887439-222887461 GATCCAGCAACCACAGTGCTTGG - Intronic
947226031 2:227840987-227841009 GGAGCAGGAACCAGAGAGCAAGG - Intergenic
948388342 2:237595496-237595518 GGCCCCGGAAGCACAATGCCAGG + Exonic
948831136 2:240598757-240598779 GGACCAGCCCCCACAGTGCAAGG - Exonic
948887019 2:240889577-240889599 GGCCCAGGAAGCAGAGAGAAGGG + Intronic
1170711762 20:18797745-18797767 TGCCCAGGTACCACTGTACAAGG + Intergenic
1171414163 20:24966227-24966249 GGCCCAGAAGCCACACTGAAGGG + Intronic
1172877882 20:38177136-38177158 GGACCAGGACCCACAGGGAAGGG - Intergenic
1172911257 20:38410891-38410913 GGCTGTGGAACCACAGAGCACGG - Intergenic
1173441905 20:43085211-43085233 GGCCCAGGAAGCACTGTGAGAGG - Intronic
1174854153 20:54026966-54026988 GGCACAGGGACCACAGTGAAGGG - Intronic
1175070234 20:56326913-56326935 GGCCGGGGAAACTCAGTGCAGGG - Intergenic
1175185815 20:57179119-57179141 AGCCCTGGAAGCACAGAGCAGGG - Intronic
1175905623 20:62378050-62378072 GGCCCTGGGGCCACAGTGAATGG - Intergenic
1176021322 20:62963741-62963763 GGCCAAGGACCCACAGTGCCTGG - Intronic
1176057007 20:63154378-63154400 CTCCCAGGGACCACCGTGCAGGG + Intergenic
1177044758 21:16155731-16155753 TTCCCAGTCACCACAGTGCAAGG - Intergenic
1178813852 21:35909144-35909166 TGCCCAGGATCCAGAGTGCTCGG - Intronic
1179160696 21:38894946-38894968 GGCCCAGGAAGTTCTGTGCATGG + Intergenic
1179588481 21:42389264-42389286 GGCCCAGGAACCACAGTGCAAGG + Intronic
1181443924 22:22953807-22953829 TCCCCAGGAGCCACAGTACATGG + Intergenic
1182427062 22:30279503-30279525 GGCTCTGGAACCCCAGTGCCGGG + Intergenic
1182481002 22:30608746-30608768 GGCCCAGGAACCCCAGCTCTTGG + Intronic
1183283037 22:36943047-36943069 GGCTCAGGAACCACTGAACATGG - Intergenic
1184851992 22:47126350-47126372 GGCTCAGGAACCACAGGGGAAGG - Intronic
1185012058 22:48319787-48319809 GGCCCAGGCACCCCTCTGCAGGG - Intergenic
1185220749 22:49628027-49628049 GGCCCAGGATGCACAATGGATGG + Intronic
950441954 3:13015604-13015626 GTCCCTGGAACCCCAGTGCCTGG + Intronic
950669120 3:14514561-14514583 GGCACTGGAGCCAGAGTGCAAGG + Intronic
950787926 3:15451147-15451169 GGCCTATGAACCACAAAGCAGGG - Exonic
951941910 3:28088635-28088657 TGCCCAGGAAGCACCATGCAAGG + Intergenic
952048538 3:29355049-29355071 GGCTCAGGAACCAAAATGCCTGG - Intronic
952345795 3:32483902-32483924 GGCTCAGGCACCACAATGCAGGG + Exonic
952927305 3:38329438-38329460 GAGCCAGGGACCACAGTGCAAGG - Intergenic
954295184 3:49670520-49670542 GGGCCAGGAAGGACAGTCCATGG - Exonic
954698075 3:52437983-52438005 GGCCCAGGCACTGCAGGGCAGGG + Exonic
955247751 3:57244010-57244032 GGACTAGGAACCAGAGTACAAGG + Intronic
955996917 3:64687637-64687659 GGCCCAGGATACAAACTGCATGG + Exonic
956134251 3:66083237-66083259 GGGGCAGGAACCACACAGCAAGG + Intergenic
958579792 3:96003273-96003295 GCCCAAGGAACCAATGTGCAAGG - Intergenic
961115331 3:124324180-124324202 GTCCCAGGAAGCATAGTGAAAGG - Intronic
961330408 3:126134911-126134933 GCCCCTGGAACCACAGGGCCTGG - Intronic
961466432 3:127084692-127084714 GGCCCAGCACCCACTGCGCATGG - Intergenic
961522862 3:127477492-127477514 GGCACAGGAAGCACAGTGCCTGG - Intergenic
962328378 3:134455231-134455253 AGCCCAAGAACCACAGTGGCAGG - Intergenic
963779805 3:149475831-149475853 GGCCCAAGAACACCAGCGCAGGG - Exonic
964744819 3:160002422-160002444 GGCCCAGGAGCCAAAGAGCTGGG + Intergenic
968525080 4:1052613-1052635 AGCCCAGGAACAGCAGCGCAGGG - Intergenic
968955163 4:3715382-3715404 GACCCAGGAACTACAGCACAGGG - Intergenic
969121149 4:4912372-4912394 TGCCCAGTAACCACAGTGGGTGG + Intergenic
969240627 4:5894651-5894673 GCCCCAGGATCCTCAGTCCATGG - Intergenic
969548639 4:7849066-7849088 GGCACAGGAACCACAGACAAAGG + Intronic
970450072 4:16157483-16157505 GGCCCAGGGACCACACTGTGGGG + Intergenic
970596151 4:17602239-17602261 GGCCCAGAAAGCACACTGCCTGG - Intronic
970615706 4:17766836-17766858 GGACCAGGCGCCACAGAGCAGGG + Intronic
971227986 4:24772507-24772529 GGCCCTGCCACCACAGTGCTTGG - Intergenic
974186841 4:58457262-58457284 GGACCAGGTGCCACAGAGCATGG - Intergenic
976203187 4:82599586-82599608 GGGTCAGGAACCACTGTTCAAGG + Intergenic
981625331 4:146748157-146748179 GGCACAGGCCCCACAGAGCAAGG - Intronic
983207914 4:164930623-164930645 GCGCCAGGTACCACAGTGGATGG - Intergenic
984698926 4:182806373-182806395 GTCCCAGGAACCCCAGGGGAAGG - Intergenic
984915539 4:184719697-184719719 GGCCCAGGCAGCACAGCCCATGG + Intronic
985818351 5:2143220-2143242 CTCCCAGGAACCTCAGTGCATGG - Intergenic
986665243 5:10096920-10096942 GACCCAGGAACCCCATTACAGGG + Intergenic
987024824 5:13915224-13915246 TGCCCAGGATTTACAGTGCAAGG + Intronic
987116889 5:14732808-14732830 GGCCCTGGAGCCACAGGGCTTGG - Intronic
987396639 5:17430684-17430706 GGCCCAGGAACCAGAGGGTTGGG + Intergenic
988292582 5:29308434-29308456 GGCTCAGGAATCATAGTGGAAGG + Intergenic
988500199 5:31777449-31777471 GGCCCAGGCGCCACGGAGCAGGG - Intronic
988698262 5:33646033-33646055 TTCCAAGGAACCACTGTGCAGGG + Intronic
990510874 5:56488009-56488031 GGACCAGGAGCCACGGAGCAGGG - Intergenic
991956728 5:72002205-72002227 GGCCCAGGACCCACAGTGCATGG - Intergenic
992280325 5:75168363-75168385 GGCCCTGGGACAACATTGCAAGG - Intronic
994260503 5:97653082-97653104 GACCCAGGAATCACATTGCTGGG - Intergenic
995753695 5:115479354-115479376 GACCCAGAAATCACAGTGCTGGG - Intergenic
997646338 5:135484518-135484540 GGCCCAGGAAACAGAGTGCATGG - Intergenic
997707957 5:135976438-135976460 TGCCCAGGAGCCACAGCACAAGG + Intergenic
998655611 5:144175624-144175646 GGCCCTGGAGCCAGACTGCATGG + Intronic
999098776 5:149005068-149005090 GTCCCAAGGACCACAGTGGAGGG - Intronic
999229173 5:150051592-150051614 GGCCTAGGAGACACAGTACATGG + Intronic
1001156735 5:169278839-169278861 GGCCCAGAACCCACAGCTCAAGG + Intronic
1002067425 5:176658948-176658970 GGCCAAGGAGCCACATTGCTGGG - Exonic
1002106111 5:176880110-176880132 GGCCCAGGAGGGACAGTGCCTGG + Exonic
1002503698 5:179664530-179664552 GCCCCTGGAGCCACAGAGCAAGG - Intergenic
1003471207 6:6435507-6435529 GACCCAGTAATCACACTGCAGGG - Intergenic
1003522902 6:6873849-6873871 AGCCCAGGAACCACAGTGGCAGG - Intergenic
1005614533 6:27559964-27559986 GGGCGAGCATCCACAGTGCATGG + Intergenic
1005801444 6:29429188-29429210 GCCTCAGGGACCACAGTGCTGGG + Intronic
1006117107 6:31781309-31781331 GGCACAGGAATCACTGAGCAGGG + Intronic
1006147389 6:31967774-31967796 GTCCCAGGACCCACAGGACAGGG + Exonic
1006153313 6:32000976-32000998 GGCCAAGGAAACCCAGTACAGGG + Intronic
1006159621 6:32033713-32033735 GGCCAAGGAAACCCAGTACAGGG + Intronic
1007409252 6:41652336-41652358 GGCACAGGGACCACACTACAGGG + Intronic
1007524596 6:42480734-42480756 GTCCCAGGAAGCACAGTGAGAGG - Intergenic
1009437958 6:63639599-63639621 GGCTCAGGAATCACACTGAATGG + Intronic
1010185057 6:73134555-73134577 GTCCCTGGAACCGCAGTCCACGG + Intronic
1011239372 6:85255053-85255075 AGGGCAGGAACCAGAGTGCAGGG - Intergenic
1011458877 6:87582119-87582141 GGCCCAGCAATCCCATTGCAGGG - Intronic
1013159879 6:107532751-107532773 GGCCCAGGAACCACATCACATGG + Intronic
1013515798 6:110884682-110884704 GGCCTCTGAACCACAGTGCCTGG + Intronic
1015459925 6:133478280-133478302 GACCCAGGAATCACATTGCCAGG + Intronic
1015462255 6:133504926-133504948 GGGCCAGGAGCCAGACTGCAGGG - Intronic
1016311625 6:142739497-142739519 GGCTCAGGAACCAGACTACATGG - Intergenic
1016817129 6:148313420-148313442 GCCCCAGGAATCACAGGACATGG - Intronic
1017183277 6:151574544-151574566 GTCCCAGACACCACAGTGGAGGG - Intronic
1018452542 6:163922469-163922491 GGCACAGGAAGCACAGTGCCTGG + Intergenic
1018736861 6:166693460-166693482 GGCGCAGGACCCTGAGTGCACGG - Intronic
1019135999 6:169908015-169908037 TGCTCAGGGAACACAGTGCAGGG + Intergenic
1019282275 7:206451-206473 GGCCAACGCATCACAGTGCACGG - Intronic
1019621252 7:1993271-1993293 TGGGCAGGACCCACAGTGCAGGG + Intronic
1021536771 7:21713983-21714005 AACCCAGGCACCACAGTGCGTGG + Intronic
1021574107 7:22091964-22091986 CCCCCAGGCACCTCAGTGCATGG + Intergenic
1021760346 7:23897332-23897354 GGCCCAGGATTCCCAGGGCACGG + Intergenic
1024598413 7:50959577-50959599 GGCCCCAGAAGCACAGAGCAGGG - Intergenic
1026858288 7:73769162-73769184 GGCCCAGGGACCAACCTGCATGG - Exonic
1027189040 7:75987368-75987390 GGCCCAGGACCCTCAGTGCAAGG - Exonic
1027252863 7:76409938-76409960 GTCCCAGGAGCCACAGTGTATGG + Intronic
1027884205 7:83882244-83882266 GGCAAAGGAATTACAGTGCAAGG + Intergenic
1028056530 7:86252333-86252355 AGCCCAGGAAGCACAGTGCAGGG + Intergenic
1031926896 7:127647576-127647598 GGCCCTGGAACCAGACTGCATGG - Intergenic
1034814389 7:154159196-154159218 GTGCCAGGAACCACGGAGCAGGG - Intronic
1035204880 7:157288862-157288884 GGCTCAGGAGCCATGGTGCACGG - Intergenic
1037571935 8:20165231-20165253 AGACCAGGAACCCCAGTACAGGG + Intronic
1038642321 8:29338250-29338272 AACCCAGGAACCCCAGAGCAGGG + Intronic
1038671060 8:29583422-29583444 GGCCCAGGGACCTAAGTGGAAGG - Intergenic
1039787759 8:40848858-40848880 GAACCAGGAACCACAATGGACGG - Intronic
1041311246 8:56519028-56519050 GTGCCAGGAGCCACAGGGCAGGG + Intergenic
1044674980 8:94719810-94719832 GGCCCGGGAACCAGAGTGTTGGG - Intronic
1045393314 8:101736372-101736394 GTCTCAGCAACCACACTGCAGGG + Intronic
1048163409 8:132040991-132041013 GGCCCAGAAATGACAGTCCAGGG - Intronic
1048402441 8:134084316-134084338 AGCCCAAGAACCAGAGGGCATGG + Intergenic
1048867419 8:138771096-138771118 GGCCCCAGGATCACAGTGCAGGG + Intronic
1049376123 8:142290001-142290023 GGCCCAGGGCCCACAGTGCCTGG - Intronic
1049412433 8:142479254-142479276 GGTCCAGGAGCCACAGTGACAGG - Intronic
1053308694 9:37001982-37002004 GACCCAGGCACCACAGGGCCAGG + Intronic
1053421618 9:37983469-37983491 TGCCCAGGAACCTCTGGGCAGGG + Intronic
1056793139 9:89639184-89639206 GCCCCAGGAGCCACACTGCGGGG - Intergenic
1057693779 9:97309632-97309654 GGCTCAGGTACCCTAGTGCATGG - Intronic
1058249135 9:102669335-102669357 ACCCCAGGCAGCACAGTGCATGG - Intergenic
1059349775 9:113656527-113656549 GGCTCTGGAACCACATTGCCTGG - Intergenic
1059404671 9:114092436-114092458 GGCCCAGGAGTCACAGTGACTGG - Exonic
1059418964 9:114179246-114179268 GGCCCAGGGAGCACAGGGCCAGG - Intronic
1060263115 9:122092986-122093008 GGCCGGGGAACCGGAGTGCAAGG - Exonic
1061564157 9:131426564-131426586 GGCCCATGGACCCCAGGGCAAGG + Intronic
1061721086 9:132551861-132551883 GGCCCGGGAAGGAAAGTGCAGGG + Intronic
1061953597 9:133950009-133950031 AGTCCAGGAACCCCAGTGCTGGG + Intronic
1188012751 X:25075040-25075062 TGCTCATGAACCACTGTGCAGGG + Intergenic
1189973986 X:46444579-46444601 GGCACAGGCACAACTGTGCAAGG + Intergenic
1190065053 X:47233781-47233803 GGCCGAGGGACGACAGTGGAGGG + Intronic
1190962316 X:55264709-55264731 GGCACAGAAACCACAGTCCGTGG - Exonic
1192228011 X:69242638-69242660 GGCCCAGGTCCCAAAGTCCAGGG + Intergenic
1193042400 X:77017403-77017425 GGCCCAGAGTCAACAGTGCATGG + Intergenic
1193090695 X:77491052-77491074 GGCCCAGGCACCACCCTTCAAGG - Intergenic
1195965252 X:110424120-110424142 GGCTCAGGAAACATAATGCAAGG + Intronic
1199255655 X:145715956-145715978 GGCCCAGTAACCACTTGGCAAGG + Intergenic
1199445931 X:147920872-147920894 GGCCCAGAAACTACAGAGTATGG + Intronic
1201232596 Y:11879586-11879608 GGACCAGGTGCCACAGAGCAGGG + Intergenic
1201334370 Y:12864307-12864329 GGTCTTGGAATCACAGTGCATGG + Intergenic