ID: 1179591501

View in Genome Browser
Species Human (GRCh38)
Location 21:42412253-42412275
Sequence CAGCACCTGTCGGGCTCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 56}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179591495_1179591501 -1 Left 1179591495 21:42412231-42412253 CCCGTGGGCAAGGCTGTCGGGCC 0: 1
1: 0
2: 0
3: 7
4: 106
Right 1179591501 21:42412253-42412275 CAGCACCTGTCGGGCTCCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1179591496_1179591501 -2 Left 1179591496 21:42412232-42412254 CCGTGGGCAAGGCTGTCGGGCCA 0: 1
1: 0
2: 1
3: 3
4: 140
Right 1179591501 21:42412253-42412275 CAGCACCTGTCGGGCTCCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1179591494_1179591501 0 Left 1179591494 21:42412230-42412252 CCCCGTGGGCAAGGCTGTCGGGC 0: 1
1: 0
2: 0
3: 3
4: 88
Right 1179591501 21:42412253-42412275 CAGCACCTGTCGGGCTCCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179591501 Original CRISPR CAGCACCTGTCGGGCTCCGT GGG Intronic
900121799 1:1051457-1051479 CAGCAGCTGGCGGCCTCCGAGGG - Exonic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
906042405 1:42798245-42798267 CAGCTCCTGCCGGCCTCTGTGGG + Intergenic
921127183 1:212188258-212188280 CAGCACCAGCCGGGCCCAGTGGG + Intergenic
1068335484 10:55628513-55628535 CAGCACCAGTCGAGCTCGCTGGG + Intergenic
1073597579 10:104816612-104816634 CAGCCCCTGACTGGCTCCATGGG - Intronic
1076542097 10:131220822-131220844 CAGCACCTCGGGGGCTCCGAGGG + Intronic
1077216419 11:1397014-1397036 CAGCATCTGTCAGGCCCCTTGGG + Intronic
1081715732 11:45248784-45248806 CAGCACCTGTCAGCCTCTGCAGG + Intronic
1083961616 11:66017771-66017793 CAGCAGCTGTCTGGCTCTGAGGG - Intronic
1092989480 12:13881320-13881342 TAGCACCTGGCGGTCTCCTTCGG + Intronic
1101726022 12:107388697-107388719 CAGCACCAGCAGGTCTCCGTTGG + Intronic
1113483290 13:110637179-110637201 GACCTCCTGTCGGGCTCCCTGGG + Exonic
1114145596 14:19973412-19973434 CAGCACCGGAGGGTCTCCGTAGG + Intergenic
1119205046 14:72787962-72787984 CAGCACCTGTGGGCCTCCTGGGG - Intronic
1122873289 14:104651127-104651149 CAGCATCTGCCGGGCACAGTGGG + Intergenic
1122931153 14:104933587-104933609 CCGCCCCTGTCCGGCGCCGTAGG - Exonic
1144504494 17:15818303-15818325 CAGCTCCTGGCGGGCTGCGGGGG - Intergenic
1145168345 17:20633817-20633839 CAGCTCCTGGCGGGCTGCGGGGG - Intergenic
1145402458 17:22552785-22552807 CAGCACCAGTCGAGCTCGCTGGG + Intergenic
1146164441 17:30576780-30576802 CAGCTCCTGGCGGGCTGCGGGGG - Intergenic
1150482255 17:65519603-65519625 CAGCAGCAGCCGGGCTCAGTGGG - Intergenic
1151955597 17:77378693-77378715 GAGTACCTGTCGGGCTCAGAGGG - Intronic
1153829851 18:8912546-8912568 CAGCACCTGTCTGGCAGCCTGGG + Intergenic
1160397310 18:78582069-78582091 CTGCACCTGTCGGGCTCAGCGGG + Intergenic
1160577160 18:79863414-79863436 CACCACCTGGCGGGGTCCGCTGG + Intergenic
929567600 2:42999544-42999566 CAGCAGCTGTGGGTGTCCGTAGG + Intergenic
936713549 2:115161236-115161258 CAACACCTGTCGGGACCCGAGGG - Intronic
938013337 2:127846760-127846782 CAGCACCTGCAGGTCTACGTTGG + Exonic
943649021 2:190437008-190437030 CAGCGCATGTGGGGCTCCCTGGG + Exonic
948424820 2:237880539-237880561 TAGCACCTGTATGGTTCCGTGGG - Intronic
1173809794 20:45948806-45948828 CAGCACAGGTCTGGCTCCCTGGG + Exonic
1178265942 21:31142776-31142798 CACCACCTGTGGGCATCCGTGGG + Intronic
1179591501 21:42412253-42412275 CAGCACCTGTCGGGCTCCGTGGG + Intronic
1179786637 21:43733996-43734018 CAGCACCTGCTGGGGTTCGTGGG + Intronic
1184525765 22:45021374-45021396 CAGCACCTGGCGTTCTCCCTGGG - Intergenic
1184676438 22:46045649-46045671 CAGCACCTGCCAGGCTCACTTGG - Intergenic
1185233764 22:49699474-49699496 CTGCACCAGTCGGTCTCCCTCGG + Intergenic
955691557 3:61595656-61595678 CAGCATCTGTCAAGCTCAGTGGG + Intronic
962998427 3:140653480-140653502 CAGCACCTGTGGGTCTACCTTGG + Intergenic
969504563 4:7576788-7576810 CAGCACCTGTCTGGCCCCTGTGG - Intronic
971341025 4:25769259-25769281 CAGCACCTCTCGGTCTCCAAGGG - Intronic
988856226 5:35230215-35230237 CAGCCCCTGCCGCGCGCCGTCGG + Intronic
1008772027 6:54990945-54990967 CAGTACTTGTCTGGCTCAGTAGG + Intergenic
1017152258 6:151291113-151291135 CACCACCTGTCAGGTTCCCTTGG + Intronic
1019644399 7:2121330-2121352 CAGCACCTGCCAGGCACCGTGGG + Intronic
1025977126 7:66378198-66378220 CAGCACCTGGCGGCCTTTGTAGG - Intronic
1030208889 7:106977222-106977244 CAGTACCTGTCTGGCTCCTAAGG - Intergenic
1032192310 7:129772046-129772068 CCGCACCAGCCGGGCTCCATCGG + Intergenic
1034674551 7:152883135-152883157 TGGCACCTGTTGGGATCCGTGGG + Intergenic
1035122832 7:156582921-156582943 CACCACCTGCTGGGCCCCGTGGG + Intergenic
1040600178 8:48875552-48875574 CAGCAACAGGCGGGCTCCTTGGG + Intergenic
1049676781 8:143892842-143892864 CGGCAACTGGCGGGCTCCGAGGG + Intergenic
1049794415 8:144489976-144489998 CAGCATCTGCCTGGCTCCCTCGG + Intronic
1057212656 9:93209196-93209218 GAGCACCTGGCGGCCTCCCTAGG + Intronic
1059496674 9:114715666-114715688 CAACACCAGTCGGGCTGTGTGGG - Intergenic
1061141619 9:128771152-128771174 ACTCACCTGTCGGGCTCCCTTGG + Intronic
1061484987 9:130915725-130915747 CAGCAACTGTCGGCCAACGTGGG + Intronic
1062655972 9:137604906-137604928 CAGCACCTGTCGCGCCCCTCCGG - Intergenic
1200748401 Y:6922830-6922852 CGGCACCTGCCGGGCTTCGTCGG - Intronic