ID: 1179592089

View in Genome Browser
Species Human (GRCh38)
Location 21:42415548-42415570
Sequence TAAGTGCCCTGCCGTGGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 89}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179592084_1179592089 14 Left 1179592084 21:42415511-42415533 CCTTGACCTTTTTTAGGGGGTGA 0: 1
1: 0
2: 2
3: 14
4: 100
Right 1179592089 21:42415548-42415570 TAAGTGCCCTGCCGTGGAGTGGG 0: 1
1: 0
2: 1
3: 7
4: 89
1179592085_1179592089 8 Left 1179592085 21:42415517-42415539 CCTTTTTTAGGGGGTGAGCAGAT 0: 1
1: 0
2: 1
3: 13
4: 126
Right 1179592089 21:42415548-42415570 TAAGTGCCCTGCCGTGGAGTGGG 0: 1
1: 0
2: 1
3: 7
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179592089 Original CRISPR TAAGTGCCCTGCCGTGGAGT GGG Intronic
901390195 1:8940521-8940543 CAAGGGCCCCCCCGTGGAGTTGG + Intergenic
915556719 1:156664887-156664909 TGAGAGCCCAGCCCTGGAGTGGG - Intergenic
920191615 1:204197359-204197381 TATGTGCCCAGCAATGGAGTGGG - Intergenic
922966606 1:229696096-229696118 TTAGTGCCCTCCCCTGGAGGAGG + Intergenic
923325050 1:232873545-232873567 CAAGAGCCATGCCATGGAGTGGG - Intergenic
1065299749 10:24310680-24310702 TATGTGCCCTGCCTTGGAAAAGG - Intronic
1065326088 10:24551994-24552016 TCAGTGTCCTGCAGTGAAGTGGG - Intergenic
1067558218 10:47286930-47286952 TAAGTGCCATGCCAGGGGGTTGG - Intergenic
1076009675 10:126977472-126977494 AAAGTGCCCTGTCTTGAAGTGGG + Intronic
1078145527 11:8719624-8719646 TAAGTGCCCCACAGTGGGGTAGG - Intronic
1078593035 11:12662158-12662180 TATGTGTCATGCTGTGGAGTCGG - Intergenic
1084883875 11:72190800-72190822 TATGAGCCCTGCTGTGCAGTCGG + Intronic
1087478687 11:98671200-98671222 TAAGGGCCTTGCTGTGGATTAGG - Intergenic
1089415290 11:118284154-118284176 TCAGGGCCCTGCCCTGGATTAGG - Intergenic
1098330655 12:69348959-69348981 CAAGTCCCCTGCCGTGATGTGGG + Intronic
1105402165 13:20105399-20105421 TAAATGCACTGCCGTGAGGTCGG + Intergenic
1108069245 13:46610849-46610871 TAAATGCCCTGCAGTGTAGTGGG - Intronic
1108204914 13:48078583-48078605 TAACTTCTCTGCCATGGAGTGGG + Intronic
1110764192 13:79264143-79264165 CCAGTGCCCTGAGGTGGAGTTGG + Intergenic
1112319893 13:98396222-98396244 TAAGGTCCCTGCTGTGCAGTCGG + Intronic
1112486850 13:99827654-99827676 TGATTGCCCTGCCCTGGTGTGGG - Intronic
1114995920 14:28351644-28351666 AAAGGTCTCTGCCGTGGAGTGGG + Intergenic
1115718630 14:36134672-36134694 CAAGTGGCCTGCCTTGGAGCAGG - Intergenic
1115774580 14:36701313-36701335 TTAGTGACCTTCTGTGGAGTGGG - Intronic
1116726440 14:48566513-48566535 TAATTGCCCTGCCCAGAAGTGGG - Intergenic
1119186549 14:72646883-72646905 TAATTCCCCTGCCCTGGAGTGGG + Intronic
1121049380 14:90810420-90810442 TAAGAGCCCTGGCTTGGAGTTGG - Intronic
1121972869 14:98374821-98374843 TAAGTGGACTGCAGTGAAGTAGG + Intergenic
1123058257 14:105582527-105582549 TAAGTGACCTGCAGTGGTGGAGG - Intergenic
1123082345 14:105701452-105701474 TAAGTGACCTGCAGTGGTGGAGG - Intergenic
1125438032 15:39669075-39669097 TTTGTGCCCAGCTGTGGAGTGGG + Intronic
1125734522 15:41914663-41914685 TTAGAGCCCTGCCGAGGACTAGG + Intronic
1130556671 15:84927685-84927707 TCCGTGCCCTGCCTTGGAGAAGG + Intronic
1131878897 15:96841471-96841493 TTAGTGCCCTGCTCTGGATTAGG - Intergenic
1138897298 16:61222220-61222242 TACGGGACCTGCCGTGGGGTGGG + Intergenic
1141726481 16:85792598-85792620 AGAGTGCCCTGGAGTGGAGTGGG + Intronic
1142257048 16:89019053-89019075 TGAGTTCCCTGCAGTGGGGTGGG - Intergenic
1152296353 17:79469428-79469450 CAGGCGCCCTGACGTGGAGTGGG - Intronic
1152413308 17:80142401-80142423 TTAGAGCCCTGCTGTGGAGCAGG - Intronic
1159135573 18:64332998-64333020 TAAATGCCCGGAGGTGGAGTTGG + Intergenic
1160921735 19:1523962-1523984 GAGGTGCCCGGCCGTGGAGTGGG - Intergenic
1160963730 19:1736437-1736459 TAAAGGCCCTGCGGTAGAGTGGG + Intergenic
1164693792 19:30228675-30228697 TAAGTGCCCTGCGGTGGCCTCGG + Intronic
925882274 2:8362856-8362878 TAAGTGGCCTCCCCTGGGGTGGG + Intergenic
928986339 2:37185991-37186013 TAAGTGCCGAGCCCTGGATTTGG - Intronic
929921910 2:46178789-46178811 TGTGTGCCCTGCCTTGCAGTAGG + Intronic
931800805 2:65756159-65756181 TAATAGCCCTGCTGTGGGGTTGG - Intergenic
931978932 2:67673864-67673886 TAAGTGCACTGCTGTGGGCTGGG - Intergenic
932824160 2:74924969-74924991 TAGGTGCCCTGCCCTGGTCTTGG + Intergenic
933639049 2:84740436-84740458 TCAGTGCCCTGTCATGGATTTGG - Intronic
936339125 2:111615956-111615978 TAAATGCCCTGCCATGAAGCGGG + Intergenic
938762956 2:134441917-134441939 TAAGTGCCCTGGGGTGGGGGTGG + Intronic
940931806 2:159441363-159441385 TAAGTGCCCTGTCTAGAAGTGGG - Intronic
947742307 2:232490309-232490331 TAAGTGCCCTGCTCTGAGGTGGG + Intergenic
1169030857 20:2405799-2405821 TCAGTTCCCAGCCTTGGAGTGGG - Intronic
1169866122 20:10201861-10201883 TAATTGCCCTGCCCTTGAATTGG - Intergenic
1175208004 20:57326810-57326832 TATGAGTCCTGCCGTGGAGCAGG + Intergenic
1176069834 20:63220361-63220383 GGAGTGCGCTGACGTGGAGTGGG + Intergenic
1179592089 21:42415548-42415570 TAAGTGCCCTGCCGTGGAGTGGG + Intronic
1182287686 22:29258025-29258047 TGAGGGCACTGCCATGGAGTGGG - Intronic
1184035991 22:41918430-41918452 CAAGGGCCCTGTCGTGGGGTAGG - Intergenic
1184089576 22:42285134-42285156 GAAGGGCCCTGCCGTGGAGTAGG - Intronic
954289850 3:49643856-49643878 TCAGTGCCCTTCCCTGGAGCAGG - Intronic
955054056 3:55440501-55440523 TTAGTACCCTGCGGTGGAGATGG - Intergenic
961817704 3:129559776-129559798 AACGTGCCCTGCGGGGGAGTGGG + Exonic
964545752 3:157831403-157831425 TAAGCCCTCAGCCGTGGAGTTGG + Intergenic
965093648 3:164193767-164193789 ATAGTGCTCTGCGGTGGAGTGGG - Intergenic
968186008 3:196634019-196634041 TCAGTGCCAGGGCGTGGAGTGGG - Intergenic
970424054 4:15930257-15930279 TATGTGTCCTGCTGTGGAGGGGG - Intergenic
971767391 4:30850702-30850724 TGAGTGTCCAGCCGTGGAATAGG - Intronic
975335480 4:73170580-73170602 TAAGTGCCAAGCCTTGGAATAGG - Intronic
979133205 4:117075195-117075217 CAAGTGACCTGCAGTGAAGTGGG - Intergenic
982751828 4:159171324-159171346 TCAGTGCCTTGACGTGTAGTAGG - Intronic
1202764812 4_GL000008v2_random:140944-140966 TAGGTGCCCTGCCCTGGTGGAGG + Intergenic
985980499 5:3458394-3458416 CAAGTGCCCTTCCGGGGAGCTGG + Intergenic
991198187 5:63960273-63960295 AAAGGGCCCTGCCGTGGAGCAGG + Intergenic
991954329 5:71977540-71977562 TAAGAGCCCTCCCTTGGAATTGG + Intergenic
995165293 5:109032593-109032615 TAACTGCCCTTCTGGGGAGTTGG - Intronic
996116859 5:119629564-119629586 TAACAGCCCTGCAGTGTAGTGGG + Exonic
997836255 5:137195706-137195728 TGAGTCACCTGCCTTGGAGTAGG - Intronic
998417809 5:141958310-141958332 TAAGTGGCCTGCCGCTGAGGAGG + Exonic
1000128533 5:158271846-158271868 TGAGTGCCCTGACTTGGAGGTGG + Intergenic
1001543290 5:172554121-172554143 TAAGTCTCCTGCCTTGGAGGAGG - Intergenic
1005871057 6:29974772-29974794 TAAGTGGCCTGGAGGGGAGTGGG + Intergenic
1019921735 7:4167614-4167636 TCAGAGCCCTGGGGTGGAGTGGG - Intronic
1025762465 7:64407327-64407349 AAAGTGCCCCGCCGAGCAGTGGG - Intergenic
1026847753 7:73707187-73707209 TAGGTGCCCTTCCCTGGAGGGGG - Intronic
1033306927 7:140231623-140231645 TAAGGCCCCTGCCGTGGAGGGGG + Intergenic
1034020921 7:147641371-147641393 TAAATGCTGTGCTGTGGAGTTGG + Intronic
1037232541 8:16675832-16675854 AAAGTGTCCTGGCTTGGAGTTGG + Intergenic
1037772081 8:21808099-21808121 TATGTGCCCAGCCCTGAAGTTGG - Intronic
1040060921 8:43102224-43102246 TATGTGCCCAGCCCTGCAGTGGG - Intronic
1040966227 8:53083454-53083476 TAAGTGCCATGCTGTGCACTTGG + Intergenic
1053000147 9:34573503-34573525 TCAGTTCCCTGCCTCGGAGTTGG - Intronic
1059709013 9:116850180-116850202 GAAGGGCCCTGCCCTGGACTGGG - Intronic
1060714459 9:125910278-125910300 TTAGGGCCCTGACGTGGAGAGGG - Intronic
1203545561 Un_KI270743v1:125832-125854 TAGGTGCCCTGCCCTGGTGGAGG + Intergenic
1199789482 X:151138997-151139019 TTAGTGCCTTGCCCTGGATTAGG + Intergenic