ID: 1179593608

View in Genome Browser
Species Human (GRCh38)
Location 21:42427708-42427730
Sequence GTTTCTCCGCACCAGGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 99}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179593608_1179593614 -4 Left 1179593608 21:42427708-42427730 CCAGGCCCCTGGTGCGGAGAAAC 0: 1
1: 0
2: 1
3: 4
4: 99
Right 1179593614 21:42427727-42427749 AAACTATTGTGCCCAGAGGGTGG 0: 1
1: 0
2: 0
3: 17
4: 131
1179593608_1179593619 12 Left 1179593608 21:42427708-42427730 CCAGGCCCCTGGTGCGGAGAAAC 0: 1
1: 0
2: 1
3: 4
4: 99
Right 1179593619 21:42427743-42427765 AGGGTGGGGTCACAGTAGCCAGG 0: 1
1: 0
2: 1
3: 21
4: 227
1179593608_1179593612 -8 Left 1179593608 21:42427708-42427730 CCAGGCCCCTGGTGCGGAGAAAC 0: 1
1: 0
2: 1
3: 4
4: 99
Right 1179593612 21:42427723-42427745 GGAGAAACTATTGTGCCCAGAGG 0: 1
1: 0
2: 1
3: 36
4: 487
1179593608_1179593615 -3 Left 1179593608 21:42427708-42427730 CCAGGCCCCTGGTGCGGAGAAAC 0: 1
1: 0
2: 1
3: 4
4: 99
Right 1179593615 21:42427728-42427750 AACTATTGTGCCCAGAGGGTGGG 0: 1
1: 0
2: 0
3: 18
4: 154
1179593608_1179593616 -2 Left 1179593608 21:42427708-42427730 CCAGGCCCCTGGTGCGGAGAAAC 0: 1
1: 0
2: 1
3: 4
4: 99
Right 1179593616 21:42427729-42427751 ACTATTGTGCCCAGAGGGTGGGG 0: 1
1: 0
2: 0
3: 6
4: 126
1179593608_1179593613 -7 Left 1179593608 21:42427708-42427730 CCAGGCCCCTGGTGCGGAGAAAC 0: 1
1: 0
2: 1
3: 4
4: 99
Right 1179593613 21:42427724-42427746 GAGAAACTATTGTGCCCAGAGGG 0: 1
1: 0
2: 1
3: 49
4: 833

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179593608 Original CRISPR GTTTCTCCGCACCAGGGGCC TGG (reversed) Intronic
902078090 1:13803267-13803289 GTTGAACCGCACCAGGAGCCTGG + Intronic
903070116 1:20722885-20722907 GTCTCTCCGCAACAGGGCCAGGG + Exonic
904755596 1:32766882-32766904 GCTCCTCTGCAACAGGGGCCAGG + Intronic
905892081 1:41523991-41524013 CTTTGTCCACACCAGGGGCCTGG + Intronic
906141796 1:43538219-43538241 GATACTCAGCACCAAGGGCCGGG - Exonic
907404810 1:54247380-54247402 TTTTCTGGGCAGCAGGGGCCTGG + Intronic
912776238 1:112508132-112508154 GTTTTCCCGCACCAGAGGCCAGG - Intronic
915967648 1:160325614-160325636 ATTCCACCGCACCAGGGGACAGG + Exonic
916211623 1:162364444-162364466 GTTTCTTCAAACCAGGGTCCTGG + Intronic
918265172 1:182835827-182835849 TTTTCCACGGACCAGGGGCCTGG + Intergenic
918433166 1:184483444-184483466 GTTTCTCCCCACTTGGGGGCGGG - Intronic
920060175 1:203222015-203222037 GTTTCCCCTCAGCAGGGGCACGG + Intronic
1063148738 10:3318760-3318782 GATTCTCCTCACCCTGGGCCTGG - Intergenic
1067233201 10:44426160-44426182 GCTTCTCCTCCCCAGGAGCCAGG - Intergenic
1071289472 10:84177782-84177804 CTTTCACAGAACCAGGGGCCTGG - Intronic
1076843960 10:133060106-133060128 GTTCCTCCGCCCCAGGCTCCTGG + Intergenic
1080839897 11:35974457-35974479 GTTTCTGCGGGCCAGGAGCCTGG + Intronic
1083036569 11:59643083-59643105 GTTACCCCCCACCAGGGGCATGG + Intronic
1084455666 11:69266816-69266838 CTTTCTCTGCACCAGGTGCAGGG - Intergenic
1084518648 11:69649808-69649830 AATTCTCAGCCCCAGGGGCCTGG - Intronic
1092074985 12:5665583-5665605 GCTTCTCCCCACCTGGAGCCAGG + Intronic
1095230813 12:39736889-39736911 GTTTCTACTCACCATGGGCTGGG - Intronic
1096763901 12:53867535-53867557 GTGTCTCCTCCTCAGGGGCCAGG + Intergenic
1100667411 12:96769976-96769998 GTATCTCTGCACCAGGTGCAAGG - Intronic
1102614329 12:114139942-114139964 GCTGCTCCTCACCAGGGCCCTGG + Intergenic
1114190310 14:20435620-20435642 GTTCCTTGGGACCAGGGGCCTGG + Exonic
1114556692 14:23566313-23566335 GTTTCTCCACCTCTGGGGCCAGG + Exonic
1122358278 14:101137408-101137430 GGTTCTCCGCACCAGGTTTCAGG - Intergenic
1123587030 15:21769930-21769952 GCTTCTCCCCACCTGGAGCCAGG - Intergenic
1123623668 15:22212495-22212517 GCTTCTCCCCACCTGGAGCCAGG - Intergenic
1123940732 15:25215422-25215444 GCTTCAGCGCACCAGGGGCTGGG - Intergenic
1127872222 15:63083170-63083192 GTTTCGCAGCAACAGGGGCCTGG - Intergenic
1134228651 16:12412047-12412069 CTGTCTCCCCACCAGGTGCCAGG - Intronic
1138200975 16:55088118-55088140 GTTTCCCCAGACCATGGGCCAGG - Intergenic
1139651366 16:68363789-68363811 GCTTCTCCTCACCAGGCCCCAGG + Exonic
1140953940 16:79845233-79845255 GTTTCTCTGCTTCTGGGGCCTGG - Intergenic
1141280992 16:82629199-82629221 GTGTCTCCTCACCCAGGGCCAGG + Intronic
1142173431 16:88634442-88634464 GCATCTCCGGACCAGGGTCCGGG + Intergenic
1143514903 17:7414664-7414686 TTTTCTCAGCACCGGGGACCAGG + Exonic
1144836482 17:18159057-18159079 GTTTGTTGGCCCCAGGGGCCTGG - Intronic
1145900606 17:28488367-28488389 GTATCCCCTCTCCAGGGGCCGGG - Intronic
1148566309 17:48634971-48634993 TTTTGTCTGCTCCAGGGGCCTGG + Intergenic
1150334528 17:64320902-64320924 GTTTCTACCCACCAGATGCCGGG + Exonic
1150488550 17:65560209-65560231 GCCTCTCCGCAAAAGGGGCCGGG + Intronic
1157801476 18:50625094-50625116 GCTTCTCCCCACCAGTGTCCTGG - Intronic
1160798715 19:957275-957297 GCTTCCCCGCACCTGGAGCCTGG - Intronic
1161818472 19:6515141-6515163 CTTTCTCAGCACCAGTGGCCTGG - Intergenic
1163030845 19:14543162-14543184 GCTTCTCCCCACAAGGAGCCTGG - Intronic
1163393748 19:17046444-17046466 GGTTCCCAGCACCAGGGACCAGG + Intergenic
1163781419 19:19251070-19251092 GTCTCTCCACACCAGGGGCCAGG + Exonic
1167338030 19:48898508-48898530 TGTTCTCCTCACCAGGTGCCTGG + Intronic
1167512542 19:49903410-49903432 GCTTCTGCACACCAGGGCCCTGG - Intronic
1167642142 19:50687788-50687810 GTTTCTCCCCACAAGGGTCACGG + Intronic
927605472 2:24482779-24482801 GTTTCTCAGCACCAGCAGCGGGG + Intergenic
931928474 2:67101242-67101264 GGTTCTCCTCTCCAGGGGCAAGG + Intergenic
933123734 2:78576589-78576611 ATGCCTCCCCACCAGGGGCCTGG + Intergenic
939079518 2:137642719-137642741 ATTTCACAGCACCAGGGGTCTGG + Intronic
942184010 2:173407124-173407146 GTTTCTCTTCCCCTGGGGCCTGG - Intergenic
1171406981 20:24918168-24918190 GATTCTCCACGCCAGAGGCCCGG + Intergenic
1175645212 20:60665003-60665025 GCTTGTCAGCACCAGGGCCCAGG - Intergenic
1176671956 21:9743765-9743787 GTTTCCCCTCTCCAGGTGCCGGG + Intergenic
1178667694 21:34563497-34563519 GTTTATCAGCACCAAGGGCAGGG + Intronic
1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG + Intronic
1179593608 21:42427708-42427730 GTTTCTCCGCACCAGGGGCCTGG - Intronic
1180061977 21:45390307-45390329 GTTCACCAGCACCAGGGGCCTGG + Intergenic
1183493511 22:38128964-38128986 GATCCTCCTCACCAGAGGCCTGG - Intronic
1183544231 22:38447195-38447217 GTTTCTCTGCCCCAGAGGGCAGG + Intronic
1183608114 22:38878817-38878839 GTTTGTCTGCACCTGGGGCAAGG + Intergenic
1184405986 22:44301084-44301106 GTTTGTCGGGAGCAGGGGCCGGG + Intronic
1184525580 22:45020699-45020721 GTTTCTCAGCTCCAGGGTCAGGG - Intergenic
953210442 3:40870469-40870491 GCTTCTCCCCTCCAGGGTCCCGG - Intergenic
954103426 3:48395895-48395917 GTTGCTCAGCAGCAGGGGCGTGG - Intronic
954580842 3:51702255-51702277 GTTTCTTCTGACCAGGGGACAGG - Intronic
961104004 3:124225602-124225624 CCTTCTCCCCACCAGGGCCCAGG - Intronic
969054543 4:4393437-4393459 GGTTCTGGGCAACAGGGGCCAGG - Intronic
971470986 4:27026941-27026963 GTTTCTACTCACTAGTGGCCTGG + Intergenic
972678819 4:41286174-41286196 GTGTCTGTGCACCAGGGGCTGGG - Intergenic
985663292 5:1168139-1168161 GCTGCTCAGCACCAGGGGCAGGG - Intergenic
985680510 5:1253433-1253455 GCTTTTCCTCACCAGGAGCCCGG - Exonic
985776535 5:1847117-1847139 TTTTCTGGGCACCTGGGGCCAGG + Intergenic
986127127 5:4893510-4893532 GTGTCGCCTCACCAGGGGTCAGG - Intergenic
986574741 5:9199927-9199949 GTTTCTCAGCACTAGGGGAATGG - Intronic
991642835 5:68771566-68771588 GTTTCTCCTGTCCCGGGGCCTGG - Intergenic
992002292 5:72447471-72447493 GTATCTGTGCTCCAGGGGCCTGG - Intronic
992072507 5:73161034-73161056 GTTTCTCCCGGCCAGGGGACTGG - Intergenic
996514402 5:124353869-124353891 GTATCTCAGCTCCAGGGACCAGG - Intergenic
1001529180 5:172450652-172450674 GTGTCTCGGCAGCAGGAGCCTGG - Intronic
1001964387 5:175900233-175900255 GTTTCTCTGCACAAAGGGTCTGG - Intergenic
1002043920 5:176531783-176531805 CTTTCTCTGCCCCGGGGGCCTGG - Intronic
1002054842 5:176592884-176592906 GCTTCTCTGCACCAGGCCCCAGG + Intronic
1007255781 6:40527341-40527363 CTTACTCTGCACCAGGGGCTTGG + Intronic
1011387611 6:86815085-86815107 GTGTCTCCTCATCAGGAGCCAGG + Intergenic
1014434635 6:121407986-121408008 GTTGCTACCCACCAGGGTCCAGG - Intergenic
1029552320 7:101244047-101244069 CTTGCTCCGCACCAGGCACCAGG + Exonic
1030350115 7:108475326-108475348 GTTTTTCCGCACATGGGGGCGGG - Intronic
1032195951 7:129788672-129788694 GTTTCTCTGCAGCAGAGGCTGGG - Intergenic
1032512944 7:132486564-132486586 GTTTGGCCGCCCCAGTGGCCTGG + Intronic
1034829124 7:154294142-154294164 GTTTCTCCGTGGCAGGGACCAGG - Intronic
1034938838 7:155217035-155217057 GATTCTGAGCACCAGGGGCTGGG + Intergenic
1038614515 8:29080405-29080427 GGTTGTCCTGACCAGGGGCCTGG + Intronic
1059191554 9:112332855-112332877 CTTTCTCGACACCAGGGGTCTGG - Exonic
1059422230 9:114199446-114199468 GTTTCTACACAGCGGGGGCCAGG - Intronic
1185596937 X:1312914-1312936 GCTTCTCCCCACCAAGAGCCTGG - Intergenic
1192576277 X:72245718-72245740 GTTTATCCATCCCAGGGGCCAGG - Intronic
1196779015 X:119365719-119365741 GTTTGTATGCATCAGGGGCCAGG + Intergenic