ID: 1179594047

View in Genome Browser
Species Human (GRCh38)
Location 21:42430505-42430527
Sequence CTGTGTGGCCAAGAGGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 328}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179594040_1179594047 2 Left 1179594040 21:42430480-42430502 CCCTCTCATTTTAGCCCAGAGAG 0: 1
1: 0
2: 2
3: 32
4: 225
Right 1179594047 21:42430505-42430527 CTGTGTGGCCAAGAGGGAGCAGG 0: 1
1: 0
2: 2
3: 35
4: 328
1179594041_1179594047 1 Left 1179594041 21:42430481-42430503 CCTCTCATTTTAGCCCAGAGAGA 0: 1
1: 0
2: 2
3: 37
4: 202
Right 1179594047 21:42430505-42430527 CTGTGTGGCCAAGAGGGAGCAGG 0: 1
1: 0
2: 2
3: 35
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179594047 Original CRISPR CTGTGTGGCCAAGAGGGAGC AGG Intronic
900727656 1:4228301-4228323 CTGTGTGGCAGGGTGGGAGCAGG + Intergenic
900982841 1:6056427-6056449 CTGTGTAAGCATGAGGGAGCAGG + Intronic
901634976 1:10666324-10666346 CAGAGAGGCCAAGAGGGGGCTGG - Intronic
903258330 1:22117537-22117559 CGGTGAGGCCAAGAGGGGGTGGG + Exonic
903685618 1:25129582-25129604 CTGTGAGCCAAAGAGGGCGCTGG + Intergenic
903822022 1:26110814-26110836 CTGTGGGGCCAACAGCGTGCGGG + Intergenic
904056283 1:27672508-27672530 CTGTGTGCCCCAGGGGGAGCTGG - Intergenic
904462498 1:30688533-30688555 CTCTGTGGCCAGGAGAGATCTGG + Intergenic
904488606 1:30844283-30844305 CTTTGTGGCCAGGAGGGAAGGGG - Intergenic
904941371 1:34166531-34166553 CTGTGTGGCCAAGGGGGCAGTGG + Intergenic
905173782 1:36124407-36124429 CTGCCTGGCCAAGAGGGACTGGG - Intronic
907390306 1:54153753-54153775 CTTTGTGTCCAACAGGAAGCGGG + Exonic
907911997 1:58835051-58835073 TTGTGTAGCCAAGAGTGAACAGG - Intergenic
907999755 1:59668530-59668552 CTGTGTGGCTTAGAGGGGGATGG - Intronic
911417117 1:97588761-97588783 GTGTGAGGCCACAAGGGAGCTGG + Intronic
912417579 1:109520496-109520518 CAGTGGGGCCAAGGGGTAGCTGG + Intergenic
916555449 1:165890733-165890755 CTGTCTGGCAGAGAGGGAGATGG + Intronic
917486477 1:175459464-175459486 ATGTGAGGCCAAGTGGGAGCTGG + Intronic
918369751 1:183847577-183847599 CTGTGTGTCCTGGAGGCAGCTGG - Exonic
920250553 1:204619725-204619747 CCGTGTGGACCAGAGTGAGCTGG - Exonic
920310314 1:205044472-205044494 CAGTGAGGCCAGGAGGGAGTGGG + Intronic
920385808 1:205569449-205569471 CTCTTCGGCCAAGATGGAGCTGG - Intronic
921761419 1:218919465-218919487 CTGTGTGGCTGAGAGGCAGGAGG - Intergenic
922155289 1:223036290-223036312 CAGTGTGGCCAAGATGGAATGGG + Intergenic
922668276 1:227490922-227490944 TGGTGGGGCCAGGAGGGAGCAGG - Intergenic
922803892 1:228375996-228376018 CTGTGTGGCCAGGCGGCAGCTGG + Exonic
923267591 1:232329492-232329514 CTCAGTGGCCAAATGGGAGCTGG - Intergenic
923515989 1:234698470-234698492 CTGAGAGGCCAAGACCGAGCAGG - Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1063008455 10:1997426-1997448 CTGTGAGCCCAAGAGTGCGCTGG - Intergenic
1064084730 10:12336783-12336805 CTGTGTGGCCCACATGGTGCTGG - Intergenic
1064429198 10:15256819-15256841 GTGTGTGGGCAAGGGGGAGAAGG - Intronic
1065640158 10:27773707-27773729 CTATGTGGGCTAGAGGGAGGGGG + Intergenic
1065773775 10:29101178-29101200 CTGTGAGGTCAGGAGGGGGCAGG + Intergenic
1065773801 10:29101264-29101286 CTGTGAGGTCAGGAGGGGGCAGG + Intergenic
1067749209 10:48958890-48958912 CTCAGTAGCCAAGAGAGAGCAGG + Intronic
1067870713 10:49958055-49958077 CTGTGGGGAGAAAAGGGAGCAGG + Intronic
1068933775 10:62616889-62616911 CTGAGTGGCCAAGGGGGAAGAGG - Intronic
1069539344 10:69281908-69281930 CTCTGTGGCCAAAATAGAGCAGG - Intronic
1069609918 10:69766213-69766235 CTGTGTGGCCAAGCGGGCTCAGG - Intergenic
1070347401 10:75558272-75558294 AAGTGTGGCCAAGAGGGTGCTGG + Intronic
1070781910 10:79142637-79142659 CTGTGTGGCCAAGTGTGGGCAGG - Intronic
1072411348 10:95204904-95204926 CTGTGTGGCCAACTTGGAGGAGG + Intronic
1072414115 10:95232586-95232608 CTGTGTCCCCAAGAGGTAGACGG - Intergenic
1072785020 10:98273474-98273496 GTGTGTGGCCAGGACGGAGAGGG - Intergenic
1072926378 10:99620447-99620469 CCGCGGGGCCAAGCGGGAGCCGG - Intronic
1073456856 10:103642318-103642340 CTGTGTAGCAAAGAAAGAGCGGG - Intronic
1073564364 10:104522518-104522540 CTCTGAGGACCAGAGGGAGCTGG - Intergenic
1074855441 10:117469708-117469730 CAGTGAAGCCAGGAGGGAGCAGG - Intergenic
1075262235 10:120973279-120973301 CTTTGTTGCCATGAGGCAGCAGG + Intergenic
1075398075 10:122142200-122142222 CTGTGGAGCCCCGAGGGAGCAGG + Intronic
1075956116 10:126524652-126524674 CTGAGTGGCCAGGTGGGATCTGG - Intronic
1076063568 10:127431062-127431084 CTGTGTGCTCAGGAGGAAGCTGG + Intronic
1076232638 10:128834625-128834647 CCCTGTGGCCCTGAGGGAGCAGG - Intergenic
1076798428 10:132809829-132809851 CTGTGAGGCCAAGAGAGGGACGG + Intronic
1077201277 11:1308951-1308973 CTGGGGGGCCATCAGGGAGCAGG + Intronic
1077366179 11:2162268-2162290 CTGGGGGGCCAGGACGGAGCTGG - Intergenic
1077582124 11:3423240-3423262 CTCAGGGGCCGAGAGGGAGCTGG + Intergenic
1079114019 11:17629152-17629174 CTGTGTGGCCACCGGTGAGCAGG + Exonic
1079387493 11:19993700-19993722 CTGGGTGGAGAAGAGTGAGCAGG + Intronic
1079657579 11:23001909-23001931 ATGAGTGGCCAAGGGGCAGCTGG + Intergenic
1079789502 11:24718134-24718156 CTGTGGGGAAAAGAGTGAGCGGG + Intronic
1080602050 11:33829716-33829738 CTGTGTGGCCAAAATGGTGGTGG + Intergenic
1081856744 11:46308719-46308741 CCGTGTGGCCAGCAGGGGGCAGG - Intronic
1081868613 11:46372948-46372970 CTGTGTAGCCCTGGGGGAGCAGG - Exonic
1082009653 11:47441616-47441638 CTGGGTGGCCAGGAAGGCGCTGG - Exonic
1082189902 11:49230551-49230573 CAGTGTGGCACAGAGAGAGCAGG + Intergenic
1083280001 11:61621009-61621031 CAGTGTGACCAAGAGGGGGAGGG - Intergenic
1083290693 11:61688503-61688525 CTGTGTGGCCAGGAGTGGGGCGG + Intronic
1084239039 11:67806057-67806079 CTCAGGGGCCGAGAGGGAGCTGG + Intergenic
1084446281 11:69205447-69205469 CAGCGTGGCCCAGAAGGAGCAGG - Intergenic
1084875459 11:72129064-72129086 CAGTGTGGCCAGCAGTGAGCTGG - Intronic
1085047206 11:73360511-73360533 CGATGAGGCCAAGAGGAAGCTGG + Exonic
1087562774 11:99812754-99812776 ATGCGTGGCCAAGATGGAGGAGG + Intronic
1089529471 11:119116927-119116949 CTCTGTGGGAAGGAGGGAGCCGG + Exonic
1089595663 11:119578020-119578042 CTGTGTCTCCAAGAGGGAGGGGG + Intergenic
1091237956 11:134034244-134034266 AGCCGTGGCCAAGAGGGAGCTGG - Intergenic
1091689866 12:2588505-2588527 CAGAGTGGCCAAGTGGGAGCTGG + Intronic
1091841409 12:3623922-3623944 CTGGGAGGCCAAGACGGAGCAGG - Intronic
1092768327 12:11872921-11872943 CTGTGTGCCCTTGAGAGAGCGGG - Intronic
1093308401 12:17547377-17547399 ATGGGTGGCCATGAGGGTGCTGG + Intergenic
1096549479 12:52362762-52362784 CAGTGTGCCCATGAGGAAGCAGG - Intronic
1097238262 12:57554736-57554758 GTGGGAGGCAAAGAGGGAGCAGG + Intronic
1098164650 12:67681582-67681604 TTGTGTAGACAAGAGAGAGCTGG + Intergenic
1099573039 12:84348976-84348998 CTGCCAGGCCAAGAGAGAGCAGG - Intergenic
1101009222 12:100431755-100431777 ATGTGTGGCAAAGAGGGAGGAGG - Intergenic
1101341625 12:103847271-103847293 GTGTGTGGCCAAGAGAGAGGCGG - Intergenic
1102869446 12:116402251-116402273 TTGGGTGGTCAAGAGAGAGCCGG + Intergenic
1103279493 12:119744244-119744266 ATGTGTGGCCAAGAGGAAAGAGG + Intronic
1103592388 12:122001474-122001496 CTGTGTGTCAAAGAGTGAGAAGG - Intronic
1104745673 12:131208692-131208714 CAGTGTGGGCATGAGGGTGCAGG + Intergenic
1104780619 12:131417678-131417700 CTGTGTGGCCAAGACTGTGAAGG + Intergenic
1105209422 13:18249088-18249110 CTCTGTGGCCCAGAAGGAGAGGG + Intergenic
1105896147 13:24718678-24718700 CTGTGAGGGCACGAGGGCGCAGG + Intergenic
1107088797 13:36453676-36453698 CTGTGTGGTTAAAAGGAAGCAGG - Intergenic
1107456538 13:40560637-40560659 CAGTCTGGCCAGGAGGGTGCTGG - Exonic
1108147859 13:47498609-47498631 CTGTCTGGGCACGAGGCAGCAGG + Intergenic
1108330949 13:49382562-49382584 CTGTGTAGTCTAGAGGGATCCGG + Intronic
1108902975 13:55435763-55435785 CTGTGCGGCCAGGAGGGTGCAGG - Intergenic
1112018901 13:95354466-95354488 TTGAGTGGCCAAGGTGGAGCTGG + Intergenic
1112759435 13:102677377-102677399 CTGTGTGGAGAACAGGCAGCGGG - Intronic
1112986660 13:105458277-105458299 CTGTGTGAGGAAGGGGGAGCTGG - Intergenic
1113756667 13:112816588-112816610 CTGAGTGGACAAGAGCGTGCTGG - Intronic
1118329404 14:64803874-64803896 GTGTTTGGCCAAGAGGGTGGAGG - Intronic
1118734553 14:68692033-68692055 CTGTGAGGGCAGGAGAGAGCTGG - Intronic
1119177678 14:72581164-72581186 CTAAGTGGCCTAGAAGGAGCTGG - Intergenic
1121102802 14:91261638-91261660 CTGTGGGGCCAGGGTGGAGCCGG + Intergenic
1121491254 14:94363129-94363151 CTGTGTGGCCCAGAGTGAGAGGG - Intergenic
1122289163 14:100670497-100670519 CTGGGTGGATAAGAGGGATCAGG - Intergenic
1123495189 15:20816939-20816961 CTGTGTGGCCAGGAAGGTCCTGG + Intergenic
1123551681 15:21386032-21386054 CTGTGTGGCCAGGAAGGTCCTGG + Intergenic
1123780925 15:23627591-23627613 CTGTGTGCCCAAGAGAAAACAGG - Intronic
1124610496 15:31204645-31204667 CTGAGTGGACGAGAAGGAGCAGG + Intergenic
1127311531 15:57755832-57755854 GTGAGTTGCCAAGAGGGAGATGG - Intronic
1127892691 15:63269262-63269284 CTGTGAGACCAAGAGGAAGGAGG - Intergenic
1128939554 15:71777332-71777354 CCGTGTGGCCAACAGGCAGACGG + Exonic
1129182282 15:73884982-73885004 CTCTGTGGCGAAGAGGGGGTTGG - Exonic
1129316912 15:74750631-74750653 CTGTGTGGGCATGCTGGAGCTGG - Intronic
1129467897 15:75734119-75734141 CTGTGAGGGCACGAGGGATCCGG + Intergenic
1130995147 15:88899332-88899354 CTGAGAAGCCAAGAGGCAGCGGG + Exonic
1202960023 15_KI270727v1_random:113274-113296 CTGTGTGGCCAGGAAGGTCCTGG + Intergenic
1133017475 16:2950869-2950891 CTGAGTGGCCACCAGGGTGCGGG - Exonic
1134018313 16:10904668-10904690 CTAAGTGGCCCAGAGGGAGGGGG + Intronic
1136254746 16:29030419-29030441 CTGTGTGGGCAGGAGAGAGATGG - Intergenic
1136317947 16:29465250-29465272 CAGTGTGGCCCAGAGGTACCTGG - Exonic
1136432522 16:30204599-30204621 CAGTGTGGCCCAGAGGTACCTGG - Exonic
1136543433 16:30942005-30942027 CTGTGTGGCCAGAAGAGAGCTGG + Intronic
1138191720 16:55018854-55018876 CTCTCTGGCCAAGAGGTTGCAGG + Intergenic
1138520966 16:57570634-57570656 CTGTGGGGCAGAGAGGGAGCTGG + Intronic
1139537710 16:67588426-67588448 CAGTGTGGCAAGGAGGGATCTGG + Intronic
1139940669 16:70603065-70603087 CTATGTGGCCACCAGGGAGCTGG + Intronic
1141572900 16:84945011-84945033 CTGGGTGGAGAACAGGGAGCAGG + Intergenic
1142473353 17:175765-175787 CTGGGTGTCCCAGGGGGAGCAGG - Intronic
1142494566 17:299483-299505 CTGAGTGGAAAAGAGGGAGCGGG - Intronic
1144562312 17:16330830-16330852 CTTTGCGGCCAAGGGGAAGCTGG + Intronic
1144632841 17:16882693-16882715 CGGGGTGGCCAAGAAGGACCAGG - Intergenic
1145257901 17:21337632-21337654 CCCTGTGGCCAGCAGGGAGCTGG - Intergenic
1145318733 17:21750374-21750396 CCCTGTGGCCAGCAGGGAGCTGG + Intergenic
1146539120 17:33679703-33679725 CTGTGAGGCCAAGGAAGAGCAGG + Intronic
1146624065 17:34422638-34422660 CAGTGGGTCCAAGAGGGAGCTGG + Intergenic
1147137665 17:38443577-38443599 CTGTGATGCCCAGAGGCAGCTGG - Intronic
1147150711 17:38511955-38511977 CTGTGGGGAGAAGAGGGCGCTGG - Exonic
1147318997 17:39634804-39634826 CTTTGTGGGCAAGAGACAGCTGG + Intronic
1147657489 17:42098944-42098966 CTGTGTGGCAGGGAGGGAGATGG - Intergenic
1148160297 17:45445959-45445981 CTGTGAGGCCCAGAGGGAGGGGG - Intronic
1148212911 17:45818996-45819018 CTGGGTCACCCAGAGGGAGCAGG - Intronic
1148690907 17:49526364-49526386 CTGAGTGGGCAGGAGGGAGGTGG - Intergenic
1149564827 17:57633658-57633680 CTAAGTGGCCAAGTGGGACCTGG - Intronic
1150391589 17:64792838-64792860 CTGTGAGGCCCAGAGGGAGGGGG - Intergenic
1150410410 17:64936976-64936998 CTGTGAGGCCCAGAGGGAGGGGG - Intergenic
1150597354 17:66617876-66617898 TTGTCAGGCCAAGAGGCAGCAGG + Intronic
1151879754 17:76887908-76887930 CTGGGGGGCCATGAGGGAGCGGG - Intronic
1152519762 17:80848572-80848594 CTGTGTGGCCACGGGTGACCGGG + Intronic
1152774537 17:82192555-82192577 CCGTGTGGCCATGATGAAGCTGG - Intronic
1153534170 18:6083031-6083053 CTTTGTGCCCAAGATGGGGCAGG - Intronic
1153924058 18:9817549-9817571 GTGTGTGGCCAAGAGGGGATTGG + Intronic
1155003715 18:21709368-21709390 CAGTGTAGCCGAGAGAGAGCAGG - Intronic
1155263208 18:24065235-24065257 CTGAAAGGCCAAGATGGAGCTGG + Intronic
1156209024 18:34919017-34919039 CTGAAAGGCCAAAAGGGAGCTGG - Intergenic
1156460114 18:37316873-37316895 CTGGGTGGCCTAGAGGCAGTGGG - Intronic
1156519318 18:37708294-37708316 GTGTGAGGCCAAAAGGAAGCAGG - Intergenic
1156697293 18:39782455-39782477 CAGAGTGGCAAAAAGGGAGCAGG + Intergenic
1157601014 18:48893307-48893329 CTGGGAGCCCCAGAGGGAGCCGG - Intergenic
1158275081 18:55758289-55758311 GTGTCTGTCCAAGAGGGAGGAGG + Intergenic
1160362732 18:78297439-78297461 CTGTGTGGCCAGGTGGGAATTGG - Intergenic
1160392319 18:78543494-78543516 CTGTGCTGGCAAGAGGGCGCGGG + Intergenic
1160618370 18:80151120-80151142 CTGTGTGGGGAAGAGGGTGGTGG + Intronic
1161978487 19:7618907-7618929 CTGTGTGGGCAGGAGGCAGCTGG - Intergenic
1163258701 19:16173520-16173542 CCGTGTGGCCCCGAGGAAGCTGG - Exonic
1165260732 19:34615182-34615204 CTGTATGGGCCACAGGGAGCAGG + Intronic
1166519618 19:43471644-43471666 CAGTGTGTCCCAGAGGGAGTGGG - Intergenic
1167783003 19:51612653-51612675 CTGTATGTCCCATAGGGAGCTGG - Intronic
1167999437 19:53432654-53432676 CTGTGTGGGCCAAAGGGATCAGG + Intronic
1168317677 19:55491125-55491147 CTGGAGGGGCAAGAGGGAGCTGG - Intronic
1168514548 19:57000714-57000736 CTATGTGGCCAAAAGAGAGTGGG + Intergenic
925017979 2:546120-546142 ATGTCTGGACAAGAGGTAGCAGG - Intergenic
925818245 2:7774253-7774275 CTGTGTGGGCCAGGAGGAGCAGG + Intergenic
925942035 2:8830066-8830088 CTGTGTGACTCAGAGGGAGATGG - Intronic
926800942 2:16660084-16660106 CAGGGTTGCCAAGAGAGAGCTGG - Intronic
927498378 2:23565496-23565518 CTCCGTAGGCAAGAGGGAGCTGG + Intronic
927889087 2:26737243-26737265 ATGTGGGGCCAGGAGAGAGCAGG - Intergenic
928680755 2:33700043-33700065 CTGTCTGACCTAGAGAGAGCAGG + Intergenic
928810921 2:35224750-35224772 CTGTATGGCCAGAAGTGAGCTGG - Intergenic
929617569 2:43324033-43324055 CTGTGAGGCCACATGGGAGCAGG - Intronic
931584013 2:63807419-63807441 GTGTAAGGCAAAGAGGGAGCAGG - Intronic
931715186 2:65023093-65023115 CTGTGAAGCCAAAAGGGACCAGG + Exonic
932300745 2:70665358-70665380 CTTTGATACCAAGAGGGAGCTGG - Intronic
933876222 2:86623711-86623733 CTGAGTGGCCGGGAGGCAGCCGG - Exonic
937383050 2:121398950-121398972 CTCTCTGGCCAAGAGAGAGAAGG - Intronic
937840441 2:126519312-126519334 CTGTGTGGCCTTGGGGCAGCAGG - Intergenic
937923003 2:127145629-127145651 CTGTGGGGCCAAGAGGGGCTGGG + Intergenic
938288706 2:130138295-130138317 CTGTGGGGCCCCCAGGGAGCAGG + Intergenic
938467827 2:131534637-131534659 CTGTGGGGCCCCCAGGGAGCAGG - Intergenic
940910620 2:159206465-159206487 CTGAGTGGCCAGCAGTGAGCAGG + Intronic
941998933 2:171627296-171627318 CGGTGTGGCAAACAGGGAGGTGG - Intergenic
942062508 2:172240703-172240725 CTGTGGGCCCAGGAGGGAGCAGG + Intergenic
942232982 2:173877098-173877120 CTGTGAGGCCCAGCGGGATCTGG - Intergenic
943659397 2:190542181-190542203 ATGTGTGTTCAAGAGGGAGTTGG - Intergenic
945680343 2:212906058-212906080 CTGTGTGGACTAGAAGGAGGTGG + Intergenic
945965521 2:216182285-216182307 CAGTGCAGCCAAGAGGGAACAGG - Intronic
946406198 2:219493214-219493236 CAGTGTGGCAAAGCGGGGGCAGG + Exonic
947414043 2:229874956-229874978 CTGCATTGCCAAGAGGGAGGTGG + Intronic
947720673 2:232367753-232367775 CTGTGTGTGCTACAGGGAGCAGG - Intergenic
948759683 2:240182930-240182952 CTGGGAGGCCCTGAGGGAGCAGG + Intergenic
948866240 2:240776182-240776204 CTGGGTGGCCCAGGGGCAGCAGG - Intronic
1168749412 20:271541-271563 GTCTGAGGTCAAGAGGGAGCAGG + Intronic
1168773592 20:431261-431283 CTGAGAGGTCAAAAGGGAGCAGG - Intergenic
1170096171 20:12648266-12648288 CTGGGTGGTCAAGAGAGAGTGGG - Intergenic
1170122214 20:12923630-12923652 CTGTGTGCCAAAGAGGCAGGAGG + Intergenic
1170692213 20:18625922-18625944 CTGTGTGGCCATGAATGGGCTGG - Intronic
1170910435 20:20561343-20561365 CTGAGTAGCTAAGAGGAAGCAGG - Intronic
1170970979 20:21116372-21116394 ATGGGAGGCAAAGAGGGAGCAGG + Intergenic
1171464920 20:25320569-25320591 CTTTGTGGCCCAGAGGAGGCTGG - Intronic
1173317699 20:41959887-41959909 GAGTGGGGCCAGGAGGGAGCTGG - Intergenic
1173433983 20:43016247-43016269 CTGTGGAGCCAAGAGTGGGCTGG + Intronic
1175186158 20:57180764-57180786 CTGTGTGGCCCAGAGTGTGTAGG - Intronic
1175187619 20:57189636-57189658 CTCTGTGGCCACCAGGGAGAAGG - Intronic
1176922016 21:14699060-14699082 CTCTGTGGTCAAGAGGGACAGGG + Intergenic
1177120496 21:17132281-17132303 CTGTCAGGCCAGGAGAGAGCAGG + Intergenic
1179168991 21:38958137-38958159 CTTTGAGGCCAAGAGGGAGCAGG + Intergenic
1179255320 21:39710843-39710865 CTGTGTGGGAGGGAGGGAGCAGG + Intergenic
1179279649 21:39923799-39923821 TTCTGTGTCCAGGAGGGAGCAGG - Intronic
1179594047 21:42430505-42430527 CTGTGTGGCCAAGAGGGAGCAGG + Intronic
1180201459 21:46227290-46227312 CTGTGTTGCCTTGAGGGAGGAGG - Intronic
1180260168 21:46663038-46663060 CTGGGTGGCCCAGAGGATGCGGG - Intronic
1180983565 22:19891033-19891055 GTGTGGTGCCAAGAGGAAGCCGG + Intronic
1183453766 22:37910583-37910605 CAGAGTGGCAAAAAGGGAGCTGG + Intronic
1183716300 22:39535434-39535456 CCGTCTTGCCCAGAGGGAGCAGG - Intergenic
1184464532 22:44660988-44661010 GTGAGAGGCAAAGAGGGAGCAGG + Intergenic
1184600592 22:45541082-45541104 CTGTGTGGTCCAGAGTGAGGGGG + Intronic
1184916091 22:47569971-47569993 CTGTGTGGCCCAGTGGTGGCTGG + Intergenic
1184942919 22:47782113-47782135 CTGTGTGGACAACAGGGTGGAGG + Intergenic
1185140022 22:49095010-49095032 CTGTGTGTCCCAGATGGGGCAGG + Intergenic
1185384394 22:50525219-50525241 CTTTCTGGCCACGAGGGCGCTGG - Intronic
950118458 3:10466277-10466299 TTCAGTGGACAAGAGGGAGCAGG - Intronic
950789836 3:15462988-15463010 CTGGGTGGAAGAGAGGGAGCTGG + Intronic
951765594 3:26194918-26194940 CAGTGAAGCAAAGAGGGAGCAGG - Intergenic
953917807 3:46931690-46931712 CTGTATGGCCAGGAGGGACCAGG - Intronic
954123748 3:48516758-48516780 CTCTGTGGGCAAGATGGGGCAGG - Intergenic
954150016 3:48652654-48652676 CTGTGGGTCCAGGAGGGAGGGGG - Intronic
954292348 3:49656303-49656325 CTGTGGGTCCAAGAGGTACCCGG - Exonic
955356045 3:58233943-58233965 CAGTGGGAGCAAGAGGGAGCAGG - Intergenic
955995793 3:64679282-64679304 CTGTGTGGAAAAGAGAGAGGGGG - Intronic
956793495 3:72698355-72698377 CTGTTTAGGCAAGAGGGACCTGG + Intergenic
957175745 3:76806304-76806326 CTGGGTGTGCAAGAGGAAGCAGG - Intronic
957909673 3:86604915-86604937 CTCCTTGGCTAAGAGGGAGCTGG + Intergenic
958818591 3:98946833-98946855 GTGTAAGGCAAAGAGGGAGCAGG - Intergenic
960383163 3:116989344-116989366 GGGTGTGGCGAAGAGGGAGTGGG - Intronic
961299873 3:125915858-125915880 CTCAGGGGCCGAGAGGGAGCTGG - Intergenic
961305935 3:125959161-125959183 CCGTGAGGCCAGGAGGGACCTGG - Intergenic
961757082 3:129134639-129134661 CTGTGTGGGCCAGAGGTAACAGG - Intronic
963271819 3:143292511-143292533 CAGTGTGGTCAAGAGGTAACAGG - Intronic
964344846 3:155745096-155745118 CTGCGGGGCCGAGAGGGAGGGGG - Intergenic
966155332 3:176910190-176910212 CAGTGTGACCAAGAGGGAGCAGG - Intergenic
966710987 3:182972797-182972819 CTGGGAGGCCAAGAGGGGGGCGG + Intronic
968528194 4:1075417-1075439 GTGGGAGGCCAAGGGGGAGCAGG + Intronic
968985287 4:3871566-3871588 CGGTGTGGCCAGGAGGGAGGTGG - Intergenic
968997783 4:3956122-3956144 CTCAGGGGCCGAGAGGGAGCTGG + Intergenic
969366261 4:6696173-6696195 CTGTGGGACCAAGCGGGACCAGG - Intronic
970256947 4:14178097-14178119 CTGTGTGACCCAGTGTGAGCTGG + Intergenic
975043172 4:69769646-69769668 CTCTGTGACCAAGAAGCAGCCGG + Intronic
975494249 4:75020514-75020536 CTGTGTGGACAACAGGGAGTAGG - Intronic
984116183 4:175683713-175683735 GTGGGAGGCAAAGAGGGAGCAGG - Intronic
985357398 4:189136225-189136247 TTTTGTGGTTAAGAGGGAGCAGG + Intergenic
985495675 5:203688-203710 GTGTGTGGCCAGGCAGGAGCGGG - Exonic
985716711 5:1467087-1467109 CTGTGTGTCCACGAGGCACCTGG - Intronic
986196105 5:5537439-5537461 CTGTGGGGAGAAGAGGGAGATGG + Intergenic
988378140 5:30465484-30465506 CTTTGTGGCCAGGAGAAAGCGGG + Intergenic
988609310 5:32710573-32710595 CTGCGTGGCCCAGGGGGAGGGGG + Intronic
988815826 5:34834187-34834209 CTGCAAGGCCAAGAGTGAGCTGG + Intergenic
990417606 5:55601176-55601198 CTGTGCAGCCAACAGGGATCAGG - Intergenic
994613445 5:102074983-102075005 CTGTGTGCCCAAGAGGAAAAGGG - Intergenic
995490302 5:112684101-112684123 CTGTGTGGACACCAGGGAGATGG - Intergenic
996547757 5:124698428-124698450 CTGTGGTGACAAGAAGGAGCTGG - Intronic
998200342 5:140113828-140113850 CTGGGTGGGGGAGAGGGAGCAGG - Intronic
998253328 5:140567133-140567155 CTGGGTGGCTAAGGGGCAGCAGG - Exonic
998392970 5:141799383-141799405 TTCTTTGGCCAAGGGGGAGCTGG - Intergenic
999243939 5:150143525-150143547 CTGTGGGGGCAAGAGGCATCTGG + Intronic
999980873 5:156956776-156956798 CTGGGTACCCAAGGGGGAGCAGG - Intronic
1000003262 5:157160227-157160249 ATGTGTAGCCAAGATGGAGGAGG - Intronic
1000885875 5:166746718-166746740 GTGGGTAGCCAGGAGGGAGCAGG - Intergenic
1001515716 5:172354006-172354028 CTGTGGGGACAAAAGGAAGCTGG + Intronic
1001541815 5:172545118-172545140 CTGGGTGTCCAAGTGGGAGCTGG - Intergenic
1002017494 5:176336697-176336719 CTGTGTGGAGAAGAGGAAGAGGG - Intronic
1002095090 5:176825911-176825933 CCGTGTGACCATGAGGGAGCTGG + Intronic
1002586383 5:180251532-180251554 CTGTGTGGCCAATGGGGAGGTGG + Intronic
1002701514 5:181128291-181128313 TGGTGTGGCCAGGTGGGAGCTGG - Intergenic
1003868020 6:10381309-10381331 TTGTGTGCCCTAGAGGGCGCTGG + Intergenic
1004277727 6:14253349-14253371 CTGTGCTCCCAAGAGGGTGCAGG - Intergenic
1004458852 6:15817045-15817067 GTTTGAGGCCAGGAGGGAGCTGG + Intergenic
1004859750 6:19790746-19790768 CTGTGTGACCTTGAGAGAGCTGG - Intergenic
1005200871 6:23342707-23342729 CTGAATGTCAAAGAGGGAGCTGG + Intergenic
1005276983 6:24229955-24229977 CTGTGTGGCCAAGAGCAGGCTGG - Intronic
1005809070 6:29502535-29502557 CTTTGTGCCCAGGAGGGAGAGGG + Intergenic
1006844323 6:37051845-37051867 CTGTGTGCCCAGCACGGAGCTGG + Intergenic
1006928484 6:37672875-37672897 CTGAGAGGCAGAGAGGGAGCAGG + Intronic
1007386456 6:41523385-41523407 CTGGGTGGCCAAGCAGGAACTGG + Intergenic
1010972029 6:82273280-82273302 CAGTGAGGCCAAGATGAAGCTGG - Intergenic
1011735167 6:90303192-90303214 CTGTGTGACTAGGAGGGAACTGG + Intergenic
1012625828 6:101402423-101402445 CTGTGCAGCCAAGTGGGAGTCGG - Intronic
1013236827 6:108204246-108204268 GTGTGTGTGCAAGGGGGAGCAGG - Intergenic
1018613045 6:165662139-165662161 CGGCCTGGCCAAGGGGGAGCCGG + Intronic
1019552173 7:1608457-1608479 AGGAGTGGCCAGGAGGGAGCTGG + Intergenic
1022983013 7:35622575-35622597 GTGTGCAGCCAAGAAGGAGCAGG - Intergenic
1023253138 7:38286492-38286514 CTGTGTTCCCAAGAAGAAGCAGG + Intergenic
1023867848 7:44247273-44247295 CTGTGTGGCCTGGGGGGACCAGG + Intronic
1023983401 7:45082173-45082195 CTCTGGGGCCCAGAGGGAGGAGG + Exonic
1025230676 7:57201620-57201642 CAGTGTGGCCAGGAGGAGGCAGG - Intergenic
1025996655 7:66531565-66531587 GTGTTTGCCCAAAAGGGAGCTGG - Intergenic
1027226725 7:76248302-76248324 CTGTGTGGGGATGAGGGAGAGGG + Intronic
1027453506 7:78359370-78359392 ATGTGTGACCAAGAGGTGGCAGG + Intronic
1028077660 7:86535141-86535163 CTGAGAGCCCAAGAGGGAGGTGG + Intergenic
1031688695 7:124764068-124764090 CAGGTTGGCCAAGAGGGAGTTGG + Exonic
1032201635 7:129826218-129826240 CTGGGTGGCCAGGCCGGAGCTGG - Intergenic
1033590532 7:142804785-142804807 CTGTGGGGGCCAGAGGGCGCAGG + Intergenic
1035264696 7:157684605-157684627 CTGTGTGGGCCGGAGGGAGGGGG - Intronic
1035522233 8:284211-284233 CTGGGTGGCCTGGAGGGACCTGG - Intergenic
1036157386 8:6355204-6355226 CTGTGAGGCCAAGATGCAGGAGG - Intergenic
1037387925 8:18363156-18363178 CTGAGAGGTCAAGAGGGATCTGG - Intergenic
1038322265 8:26538468-26538490 CTGTGGGGGAAAAAGGGAGCGGG + Intronic
1039728498 8:40249175-40249197 TAGTGTTGCCAAGAGGGAGATGG - Intergenic
1041898515 8:62955028-62955050 CACTGTGGCAAAGAGGCAGCAGG - Intronic
1042963024 8:74322355-74322377 CTGTGTGCCCAACAGGTAGACGG + Intronic
1045918630 8:107503307-107503329 CTGTGTGGCCATGAGAGACTTGG + Intergenic
1046652206 8:116848707-116848729 CTGTTAGGCCAAGAGTAAGCCGG - Intronic
1047509965 8:125508598-125508620 CTGTGTGGCAAAGAGACGGCTGG - Intergenic
1047677005 8:127213208-127213230 CTGTGTTGCTAACAGGAAGCAGG + Intergenic
1048531314 8:135253013-135253035 CTGTGTGGGCAGCAGGGGGCTGG - Intergenic
1049576286 8:143391410-143391432 CTGTGTGCCCAACATGGAACAGG + Intergenic
1049962591 9:750846-750868 GAGTGTTGCCATGAGGGAGCTGG + Intergenic
1051088710 9:13381272-13381294 CTGGGTCTCCAAGAGGGAGCAGG + Intergenic
1051682936 9:19626280-19626302 CTGAGTGGCCCTGAGGCAGCTGG - Intronic
1051764982 9:20513684-20513706 CTGTATGTCCATGAGGGAGGTGG + Intronic
1052025356 9:23567948-23567970 CAGTGTGGCCAAAAAGCAGCTGG - Intergenic
1052796926 9:32931460-32931482 GTGTGAGGCCAGGAGGGAGGGGG - Intergenic
1052834515 9:33240574-33240596 CTGTGGGGACAGAAGGGAGCAGG + Intronic
1055701920 9:78954144-78954166 CAGTGTGGTTAGGAGGGAGCAGG - Intergenic
1056504644 9:87246645-87246667 CTGTGTTGCAAACAGAGAGCAGG - Intergenic
1057299757 9:93870994-93871016 CTGTGTGTCCAAGTTGGAACAGG - Intergenic
1057371565 9:94479257-94479279 ATGGGTGGCCACGAGGGAGACGG + Intergenic
1057549229 9:96039812-96039834 TGGTGTGGCCAAGACAGAGCAGG + Intergenic
1060633615 9:125182207-125182229 TTGTGAGGGCAAGAGGGAACTGG - Intronic
1061287906 9:129634662-129634684 CTGTTAGGCTAAGAGGGTGCAGG - Intronic
1061406127 9:130393950-130393972 CTGTGTGGCCGTGAGCGAGGCGG + Intronic
1061445409 9:130634553-130634575 GTGTGTGGCCAGGAGCGAGGTGG + Intronic
1061931173 9:133833923-133833945 CTGTGGGGCAGAGAGGGGGCTGG - Intronic
1062043917 9:134416518-134416540 CTGTGTGGCCAGGGTGGGGCCGG + Intronic
1062095233 9:134699713-134699735 AGGTTTGGCCAAGTGGGAGCAGG + Intronic
1062582504 9:137234765-137234787 CTGTGGGGCTGAGAGGAAGCTGG - Intronic
1062722572 9:138052020-138052042 CTGGGGGGCCACGTGGGAGCTGG + Intronic
1187017775 X:15347317-15347339 ATGTGTGGCCCACAGAGAGCTGG + Exonic
1187652138 X:21420859-21420881 CAGGGTGGCCAAGAGAGTGCTGG - Intronic
1188514846 X:30974167-30974189 CTCTGTGGCCATGAAAGAGCAGG + Intronic
1189318013 X:40069440-40069462 CGGTGTGGCCAATGGGGAGCAGG - Intronic
1189823975 X:44898516-44898538 CTGTGTGTGCAGGAGGGAGGTGG + Intronic
1189883529 X:45515977-45515999 CTGTGTGGGTGAAAGGGAGCAGG + Intergenic
1190567266 X:51743590-51743612 CTGTGTGGCAGTGAGGGAGCGGG - Exonic
1196595166 X:117537508-117537530 CTGTGTTGAGAAGATGGAGCTGG - Intergenic
1196893011 X:120308740-120308762 CGGTGTTGCCAAAAGGGAGAAGG + Intronic
1198338846 X:135693876-135693898 CAGTGGGGCCAAGGAGGAGCAGG - Intergenic
1198809473 X:140520942-140520964 CAGTGTGGCTAAGAGGTAGAAGG + Intergenic
1200090515 X:153633795-153633817 CTGTGGGGCCAACAGGGAGGAGG + Intergenic
1200123222 X:153800957-153800979 CTGTGCGGCAGAGAGGCAGCTGG + Intergenic
1200395679 X:155986001-155986023 CAGTTTGGCCAGGAGGGAGTGGG - Intergenic
1200887220 Y:8281675-8281697 CTATCTGGCCAAGAAGGAGGAGG - Intergenic
1201296054 Y:12464078-12464100 CTGGGAGGCCAAGAGGGGGTTGG + Intergenic