ID: 1179596675

View in Genome Browser
Species Human (GRCh38)
Location 21:42447345-42447367
Sequence GTTACAAAGGCGAAAGCCGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 36}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179596675_1179596688 26 Left 1179596675 21:42447345-42447367 CCTCCGGCTTTCGCCTTTGTAAC 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1179596688 21:42447394-42447416 AGCCCAGCTGCGGGGAGCACAGG 0: 1
1: 0
2: 0
3: 32
4: 336
1179596675_1179596684 17 Left 1179596675 21:42447345-42447367 CCTCCGGCTTTCGCCTTTGTAAC 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1179596684 21:42447385-42447407 TCGTCCACCAGCCCAGCTGCGGG 0: 1
1: 0
2: 3
3: 8
4: 180
1179596675_1179596689 27 Left 1179596675 21:42447345-42447367 CCTCCGGCTTTCGCCTTTGTAAC 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1179596689 21:42447395-42447417 GCCCAGCTGCGGGGAGCACAGGG 0: 1
1: 1
2: 2
3: 17
4: 444
1179596675_1179596685 18 Left 1179596675 21:42447345-42447367 CCTCCGGCTTTCGCCTTTGTAAC 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1179596685 21:42447386-42447408 CGTCCACCAGCCCAGCTGCGGGG 0: 1
1: 0
2: 1
3: 14
4: 255
1179596675_1179596683 16 Left 1179596675 21:42447345-42447367 CCTCCGGCTTTCGCCTTTGTAAC 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1179596683 21:42447384-42447406 ATCGTCCACCAGCCCAGCTGCGG 0: 1
1: 0
2: 0
3: 11
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179596675 Original CRISPR GTTACAAAGGCGAAAGCCGG AGG (reversed) Exonic
908309335 1:62860949-62860971 TTTACAAAGGAAAAAGCTGGAGG - Intronic
911744010 1:101419251-101419273 CTTTCAAAGGCCAAAGCAGGTGG + Intergenic
919919539 1:202160053-202160075 GTTACAGAGGCGGGAGACGGGGG - Intronic
1067323422 10:45244102-45244124 GCTACAAAGTGGAAAGGCGGGGG - Intergenic
1076096756 10:127738910-127738932 GTGACTGAGGCGGAAGCCGGCGG - Exonic
1079937794 11:26639277-26639299 GTTACAAAGAGGAAAGCTAGAGG + Intronic
1081677675 11:44980486-44980508 GTTACAGAGGAGAAAACAGGGGG + Intergenic
1090274421 11:125409580-125409602 GATACAAAGGTGAGAGCTGGAGG + Intronic
1091894224 12:4088026-4088048 GTTCCAAAGGAGAATGCCAGGGG - Intergenic
1107320494 13:39181261-39181283 GTTACAAATGAAAAAGCAGGTGG - Intergenic
1113893130 13:113747047-113747069 GTTACTGAGGCTAAGGCCGGAGG + Intergenic
1115302757 14:31902890-31902912 GTTACACAGGCCAAAACCTGTGG + Intergenic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1124662996 15:31566475-31566497 GTTACAAAGGGGAAATCCAATGG + Intronic
1129579561 15:76792994-76793016 GTTAGAAAGGAGAAAGATGGTGG - Intronic
1139007978 16:62596778-62596800 CTTACTAAGGGGAAAGCCAGAGG - Intergenic
1155379303 18:25201441-25201463 GTTATTAAGGCTAAAGCCAGGGG - Intronic
933833580 2:86229173-86229195 TTTACAAAGAAGAAAGCCTGAGG + Intronic
1174699932 20:52597922-52597944 GATACAAAGGTGAAGGCCAGAGG + Intergenic
1179596675 21:42447345-42447367 GTTACAAAGGCGAAAGCCGGAGG - Exonic
1183338680 22:37266046-37266068 GTTACAAAGGCCCAGGCCAGGGG - Intergenic
1003454277 6:6266732-6266754 GTTACAAAGTGGAAAGTGGGGGG - Exonic
1007369597 6:41417660-41417682 GTGACAAAGAGGAAAGACGGAGG - Intergenic
1008704029 6:54136757-54136779 GAAACAAAGGAGAAAGCAGGTGG - Exonic
1027688477 7:81309211-81309233 GTTACAAAGGAGAAAGCATTTGG + Intergenic
1032874899 7:136027789-136027811 GTGAAATAGGAGAAAGCCGGAGG - Intergenic
1039064892 8:33599436-33599458 GTTACAAAGGCGACCGCAGGCGG - Intronic
1049650833 8:143768379-143768401 TTTACAAAGGAGAAACCTGGCGG - Intergenic
1050238328 9:3606970-3606992 TTTAAAAAGGAGAAAGCTGGAGG - Intergenic
1050977010 9:11951205-11951227 GGTACAAAGCAGAAAGGCGGTGG + Intergenic
1057353115 9:94316713-94316735 TTCCCAAAGGCGAAAGCGGGTGG + Intergenic
1057654630 9:96940878-96940900 TTCCCAAAGGCGAAAGCGGGTGG - Intronic
1059519186 9:114923849-114923871 TTTACAAAGGCGATAGTTGGTGG + Intronic
1061864532 9:133485564-133485586 GTTGCATAGGCCAAAGCAGGGGG - Intergenic
1187047365 X:15660396-15660418 GTTACAGAGGCCAAGGCAGGAGG - Intronic
1189380632 X:40500081-40500103 TTTACAGAGGTGAGAGCCGGTGG - Intergenic
1189545152 X:42035097-42035119 GTTACACAGCAGAAAGCAGGAGG - Intergenic
1197432596 X:126384474-126384496 GTTACAAATGCAAAAGCCTCAGG + Intergenic