ID: 1179597852

View in Genome Browser
Species Human (GRCh38)
Location 21:42455080-42455102
Sequence AAGGAGAACAAAATGGCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179597852_1179597856 28 Left 1179597852 21:42455080-42455102 CCTTGAGCCATTTTGTTCTCCTT No data
Right 1179597856 21:42455131-42455153 GAAAATATAACCAGACTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179597852 Original CRISPR AAGGAGAACAAAATGGCTCA AGG (reversed) Intergenic
No off target data available for this crispr