ID: 1179598458

View in Genome Browser
Species Human (GRCh38)
Location 21:42459691-42459713
Sequence TGGTAGTTATTGGTGCTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179598458_1179598465 -3 Left 1179598458 21:42459691-42459713 CCATGCAGCACCAATAACTACCA No data
Right 1179598465 21:42459711-42459733 CCAGGTAGGGGCTTCCCACGTGG No data
1179598458_1179598466 0 Left 1179598458 21:42459691-42459713 CCATGCAGCACCAATAACTACCA No data
Right 1179598466 21:42459714-42459736 GGTAGGGGCTTCCCACGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179598458 Original CRISPR TGGTAGTTATTGGTGCTGCA TGG (reversed) Intergenic
No off target data available for this crispr