ID: 1179598465

View in Genome Browser
Species Human (GRCh38)
Location 21:42459711-42459733
Sequence CCAGGTAGGGGCTTCCCACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179598458_1179598465 -3 Left 1179598458 21:42459691-42459713 CCATGCAGCACCAATAACTACCA No data
Right 1179598465 21:42459711-42459733 CCAGGTAGGGGCTTCCCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179598465 Original CRISPR CCAGGTAGGGGCTTCCCACG TGG Intergenic
No off target data available for this crispr