ID: 1179598466

View in Genome Browser
Species Human (GRCh38)
Location 21:42459714-42459736
Sequence GGTAGGGGCTTCCCACGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179598458_1179598466 0 Left 1179598458 21:42459691-42459713 CCATGCAGCACCAATAACTACCA No data
Right 1179598466 21:42459714-42459736 GGTAGGGGCTTCCCACGTGGAGG No data
1179598463_1179598466 -10 Left 1179598463 21:42459701-42459723 CCAATAACTACCAGGTAGGGGCT No data
Right 1179598466 21:42459714-42459736 GGTAGGGGCTTCCCACGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179598466 Original CRISPR GGTAGGGGCTTCCCACGTGG AGG Intergenic
No off target data available for this crispr