ID: 1179603908

View in Genome Browser
Species Human (GRCh38)
Location 21:42499648-42499670
Sequence GTGCGGCTCTGCAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 340}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179603892_1179603908 22 Left 1179603892 21:42499603-42499625 CCACAGAGGCCCTTCCCATAACC 0: 1
1: 0
2: 4
3: 23
4: 220
Right 1179603908 21:42499648-42499670 GTGCGGCTCTGCAGGGAGGAGGG 0: 1
1: 0
2: 3
3: 41
4: 340
1179603891_1179603908 29 Left 1179603891 21:42499596-42499618 CCATCATCCACAGAGGCCCTTCC 0: 1
1: 0
2: 2
3: 19
4: 278
Right 1179603908 21:42499648-42499670 GTGCGGCTCTGCAGGGAGGAGGG 0: 1
1: 0
2: 3
3: 41
4: 340
1179603898_1179603908 7 Left 1179603898 21:42499618-42499640 CCATAACCCCCAAGTGGGAAGTT 0: 1
1: 1
2: 0
3: 7
4: 192
Right 1179603908 21:42499648-42499670 GTGCGGCTCTGCAGGGAGGAGGG 0: 1
1: 0
2: 3
3: 41
4: 340
1179603899_1179603908 1 Left 1179603899 21:42499624-42499646 CCCCCAAGTGGGAAGTTCGCGCA 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1179603908 21:42499648-42499670 GTGCGGCTCTGCAGGGAGGAGGG 0: 1
1: 0
2: 3
3: 41
4: 340
1179603895_1179603908 12 Left 1179603895 21:42499613-42499635 CCTTCCCATAACCCCCAAGTGGG 0: 1
1: 0
2: 0
3: 13
4: 145
Right 1179603908 21:42499648-42499670 GTGCGGCTCTGCAGGGAGGAGGG 0: 1
1: 0
2: 3
3: 41
4: 340
1179603901_1179603908 -1 Left 1179603901 21:42499626-42499648 CCCAAGTGGGAAGTTCGCGCAAG 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1179603908 21:42499648-42499670 GTGCGGCTCTGCAGGGAGGAGGG 0: 1
1: 0
2: 3
3: 41
4: 340
1179603900_1179603908 0 Left 1179603900 21:42499625-42499647 CCCCAAGTGGGAAGTTCGCGCAA 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1179603908 21:42499648-42499670 GTGCGGCTCTGCAGGGAGGAGGG 0: 1
1: 0
2: 3
3: 41
4: 340
1179603890_1179603908 30 Left 1179603890 21:42499595-42499617 CCCATCATCCACAGAGGCCCTTC 0: 1
1: 0
2: 1
3: 11
4: 191
Right 1179603908 21:42499648-42499670 GTGCGGCTCTGCAGGGAGGAGGG 0: 1
1: 0
2: 3
3: 41
4: 340
1179603897_1179603908 8 Left 1179603897 21:42499617-42499639 CCCATAACCCCCAAGTGGGAAGT 0: 1
1: 0
2: 0
3: 11
4: 144
Right 1179603908 21:42499648-42499670 GTGCGGCTCTGCAGGGAGGAGGG 0: 1
1: 0
2: 3
3: 41
4: 340
1179603893_1179603908 13 Left 1179603893 21:42499612-42499634 CCCTTCCCATAACCCCCAAGTGG 0: 1
1: 0
2: 1
3: 10
4: 178
Right 1179603908 21:42499648-42499670 GTGCGGCTCTGCAGGGAGGAGGG 0: 1
1: 0
2: 3
3: 41
4: 340
1179603902_1179603908 -2 Left 1179603902 21:42499627-42499649 CCAAGTGGGAAGTTCGCGCAAGT 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1179603908 21:42499648-42499670 GTGCGGCTCTGCAGGGAGGAGGG 0: 1
1: 0
2: 3
3: 41
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179603908 Original CRISPR GTGCGGCTCTGCAGGGAGGA GGG Intronic
900414482 1:2528677-2528699 GAGCGGGTCTGCAGGGGTGAAGG - Intergenic
900416702 1:2538573-2538595 GAGCGGCTCTGCACACAGGAGGG - Intergenic
900527745 1:3137362-3137384 ATGAGGCTTTGCAGGAAGGAGGG - Intronic
901443705 1:9293813-9293835 GTGCGGGTCTGCAGGAAGAGCGG + Intronic
903323465 1:22556149-22556171 GTGCTGCTCCGCATGGGGGAGGG - Intergenic
903421055 1:23217783-23217805 GTAGGGGTCTGCAGGGAGGTGGG + Intergenic
903735943 1:25530078-25530100 GTGCGGCTGGGCGGGGAGGGAGG - Intergenic
903762887 1:25711650-25711672 GGGCGGGGCCGCAGGGAGGAGGG - Intronic
903886317 1:26543032-26543054 TTCCCCCTCTGCAGGGAGGAGGG - Intronic
904577916 1:31517380-31517402 GGGTGACTCTGCAGGGAGGCTGG - Intergenic
905395690 1:37665055-37665077 GGGCTGCCCTGCAGGAAGGAAGG - Intergenic
905939197 1:41849461-41849483 GTGAGCATCTGCATGGAGGAGGG - Intronic
905972555 1:42153084-42153106 GTGAGGCTCAGGAGGGAGGGTGG - Intergenic
906863914 1:49394768-49394790 GTCCGCCTCAGCAGGGAGGATGG + Intronic
907852220 1:58266504-58266526 GTGAGGCTCAGCAGGGAGAAAGG - Intronic
907868695 1:58423535-58423557 GTGCTGCTCTGCTTGGAGGTCGG - Intronic
910471699 1:87560243-87560265 GTGCAGCTTTGCTGGGAAGAGGG - Intergenic
912567657 1:110599821-110599843 GTGCGGATTTGCTGGAAGGAAGG + Intronic
912698929 1:111861703-111861725 GGAGGGCTCTGCAGGGAAGAGGG + Intronic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
915278142 1:154803840-154803862 GTGAGGCTCTGTAGAGAGAATGG - Intronic
915468995 1:156114655-156114677 GTCCTCCTCTGAAGGGAGGAGGG - Intronic
915511816 1:156390799-156390821 GTGAGGAATTGCAGGGAGGAGGG - Intergenic
915607192 1:156959976-156959998 TTCCAACTCTGCAGGGAGGATGG + Intronic
915615425 1:157034138-157034160 CTGGGGCTCTGAAGGGAAGAGGG + Intronic
916236379 1:162592871-162592893 TTGGGGGTCTGGAGGGAGGATGG + Intronic
917512776 1:175681892-175681914 ATGGGGGTCTGAAGGGAGGAAGG + Intronic
917535734 1:175873072-175873094 GTGGGGGGCTGAAGGGAGGAGGG - Intergenic
917621594 1:176801848-176801870 GTGCTGGGGTGCAGGGAGGAGGG - Intronic
918860717 1:189823602-189823624 GGGAGGCTCTGCAGGCAGAACGG - Intergenic
920074758 1:203327847-203327869 GAGGGACTCTGGAGGGAGGACGG - Intergenic
920388195 1:205582546-205582568 GTGGGGCTTTCCAGGGAGGTGGG - Intronic
920671888 1:208010001-208010023 GTACAGATTTGCAGGGAGGAGGG + Intergenic
921257951 1:213359444-213359466 GTGTGTCTCTGCAGGGGAGATGG + Intergenic
921318433 1:213914446-213914468 GTGCTGCTGAGCAGGCAGGATGG - Intergenic
922784470 1:228276206-228276228 GTGGGGCACTGAGGGGAGGAGGG + Intronic
1063923275 10:10952246-10952268 GTGCGGAACTTCAGGGGGGAAGG - Intergenic
1063968982 10:11368144-11368166 GTGGGACTCCCCAGGGAGGAAGG + Intergenic
1065168723 10:23006982-23007004 GTGAGTCTCTGCAGGGAGAGGGG + Intronic
1065665903 10:28060438-28060460 GTTGGGATCTGCAGGAAGGATGG - Intronic
1069622142 10:69844240-69844262 GTGTGGCTGTCCAGGGAGGATGG + Intronic
1069902820 10:71715727-71715749 GAGGGGGTCTGCAGAGAGGAAGG + Exonic
1069958761 10:72067581-72067603 TTGCTGCTCTGCCTGGAGGAGGG - Intronic
1070286076 10:75084941-75084963 GCGCAGCTCTGCTGGGAGGGTGG - Intergenic
1070321560 10:75358598-75358620 GTAGGGCTCGGGAGGGAGGAAGG - Intergenic
1074226272 10:111487622-111487644 GTGGGGGTTTGCAGGGAAGATGG - Intergenic
1075065801 10:119288169-119288191 GGGAGGCTCTGCAGGCAGAAAGG - Intronic
1075335922 10:121608888-121608910 GGGCGGCCGGGCAGGGAGGAGGG + Intergenic
1075646539 10:124100557-124100579 GTCCGACTCTGAAGGCAGGAGGG + Intergenic
1075847520 10:125556621-125556643 TGGCCGCTCTGCAGGGAGGCGGG + Intergenic
1076367855 10:129933882-129933904 GTGGGGCTGAGCAGAGAGGAGGG - Intronic
1078000491 11:7490772-7490794 GTGCTGCACTGCAGGGATGGAGG + Intronic
1078570669 11:12455150-12455172 GTGTGTCTCTTCAGGGAAGATGG + Intronic
1080567173 11:33521256-33521278 GTGCTGCTCTGTAGTGAGGCAGG + Intergenic
1081571441 11:44293881-44293903 GGATGGCTCTGGAGGGAGGAGGG + Intronic
1081687803 11:45054891-45054913 GGGAGGCTCTGGAAGGAGGAGGG - Intergenic
1081728789 11:45353952-45353974 ATGCGGCATTGCAGGGAGCAAGG - Intergenic
1083293115 11:61700698-61700720 GTGCAGGACTGCAGGGAGGGAGG - Intronic
1083307863 11:61770231-61770253 GTGGGGCTCTGCAGGAGAGATGG - Exonic
1083400986 11:62423501-62423523 GTGCAGCCCAGCGGGGAGGATGG - Intergenic
1083439150 11:62664781-62664803 CCGGAGCTCTGCAGGGAGGAAGG + Intronic
1084184831 11:67465972-67465994 GGGAGGCTCAGCTGGGAGGATGG + Intronic
1084256588 11:67947035-67947057 GTGCAGATCTGGAGGGTGGAAGG - Intergenic
1084317716 11:68354968-68354990 GTCAGCCTCTGCAGGGAAGAGGG + Intronic
1084386554 11:68846505-68846527 GTCCGGCTCTGAAGGGACGACGG - Intergenic
1084672025 11:70612655-70612677 GGGTGCCTCTGCAGGGAGGAAGG - Intronic
1084816194 11:71648308-71648330 GTGCAGCTCTGGAGGGGGGCAGG + Intergenic
1085041357 11:73328267-73328289 GTGGGGCTATGCAGGAGGGATGG + Intronic
1088391459 11:109319478-109319500 CTGAGGCACTGCAGGCAGGAAGG - Intergenic
1088598556 11:111456993-111457015 GTCCTGCTCTGCAGGGCTGAAGG + Intronic
1089377247 11:118003156-118003178 ATGCTGCTCTGCTGGGTGGAAGG + Intergenic
1089681323 11:120120512-120120534 GTGGGGCTGTGCAGGCAGGAGGG - Intronic
1090183376 11:124719778-124719800 GGGGGGCTCAGCAGGGACGATGG - Intergenic
1090469619 11:126968793-126968815 ATGGGGCTCTGCAGTGAGAAAGG + Intronic
1091235180 11:134017156-134017178 GAGTGGCACTGCAGGGAGGCAGG + Intergenic
1091361652 11:134982711-134982733 GTGCCGCTCTGCAGCGGGGAGGG + Intergenic
1091792623 12:3280504-3280526 GTGGGGCCAGGCAGGGAGGAGGG + Intronic
1092426801 12:8381735-8381757 GTGCAGCTCTGGAGGGGGGCAGG - Intergenic
1094480232 12:30875687-30875709 GTGCAGCTCAGTAGGGAGGGGGG - Intergenic
1095687570 12:45052062-45052084 GTACGTCTCTGCAGGGAGACGGG + Intergenic
1096265690 12:50120753-50120775 GTGCAGCTCTGCATCAAGGAGGG + Intergenic
1096758391 12:53818862-53818884 GTCCAGCTGTGGAGGGAGGATGG - Intergenic
1096978766 12:55716510-55716532 GAGCGACTCTGGAGGGAGGAGGG + Intronic
1097168514 12:57098951-57098973 GTGCTTATCTGCAGGAAGGAGGG - Intronic
1097190185 12:57216122-57216144 GTGCGCCTCTGCATGGGGGCTGG - Intergenic
1100993104 12:100271240-100271262 TTGCTGCTCTGCAAGGAGCAGGG - Intronic
1101182566 12:102235376-102235398 GTGGGGCTGGGCAGGGAGGGTGG - Intergenic
1102345927 12:112161468-112161490 CTACGTCACTGCAGGGAGGAAGG + Exonic
1102569778 12:113820434-113820456 GTGGGAGCCTGCAGGGAGGAAGG + Intronic
1103325608 12:120117729-120117751 CTGCAGTTCTGCAGTGAGGATGG - Intergenic
1103649355 12:122421664-122421686 GTGGGGCTGTGCAGGGAGGAGGG + Intronic
1104607118 12:130198325-130198347 CTCATGCTCTGCAGGGAGGAGGG - Intergenic
1104678836 12:130734787-130734809 GGGAGGCTTTGCAGGGAGGGAGG - Intergenic
1104759688 12:131289479-131289501 CTGAGGCTGTGCAGGGAGGAGGG - Intergenic
1104821025 12:131677734-131677756 CTGAGGCTGTGTAGGGAGGAGGG + Intergenic
1104870889 12:131994577-131994599 GTGGGGCTCTGCAGGAAGGTAGG + Intronic
1106670795 13:31903046-31903068 ATGTGGCTCTAGAGGGAGGAAGG + Intergenic
1112274570 13:98004535-98004557 GTGCCTCACTGCAGGAAGGAAGG - Intronic
1112453226 13:99531642-99531664 GTGGGGCTCTGTTGGAAGGAGGG + Intronic
1113012473 13:105785655-105785677 TTTCGACTGTGCAGGGAGGAAGG - Intergenic
1113603578 13:111588667-111588689 ATGCAGCTCTGTAGGGAGGGAGG + Intronic
1115495623 14:34001539-34001561 CTGGGGCTTTCCAGGGAGGAAGG + Intronic
1115653339 14:35419689-35419711 GTGTGGCTGTGCAGGAAGGAGGG + Intergenic
1117971476 14:61255016-61255038 GTGTGGGACTGCAGTGAGGATGG - Intronic
1118102589 14:62623459-62623481 GTGCGGCAGTGCAGCTAGGATGG - Intergenic
1118315605 14:64724083-64724105 GTGGTGCTCTTCAGGTAGGAAGG + Intronic
1118748092 14:68788793-68788815 GTGTAGGTCTGCAGGAAGGAAGG - Exonic
1118926358 14:70193246-70193268 GAACAGCTCTGTAGGGAGGATGG + Intergenic
1119262555 14:73246058-73246080 GGGCAGCTCTGCGGGGCGGAGGG - Exonic
1120509801 14:85399372-85399394 GTGGGGCTCTGGGGAGAGGAGGG + Intergenic
1121341890 14:93110411-93110433 GAGATTCTCTGCAGGGAGGAAGG - Intronic
1121762217 14:96455378-96455400 GTGAGGCTGAGCTGGGAGGATGG + Intronic
1121960300 14:98253442-98253464 GAGGGGCTCTGAAGGGAGGGGGG + Intergenic
1122084032 14:99287178-99287200 GTGGGGCGCTGGGGGGAGGAGGG - Intergenic
1122338189 14:101007444-101007466 GTGGGGTTTTGCAGGGAGCAGGG - Intergenic
1124071084 15:26393653-26393675 TAGGGGCACTGCAGGGAGGAGGG + Intergenic
1125723918 15:41858579-41858601 GTGAGGCCCTGCAGGCAGGAGGG - Intronic
1126706081 15:51406354-51406376 CTGGGGCTCTGCAGCCAGGAAGG + Exonic
1127973282 15:63978864-63978886 ATGCCACCCTGCAGGGAGGAAGG - Intronic
1128153014 15:65375306-65375328 GTGCTGGACTGCAGGGTGGAGGG - Exonic
1128178642 15:65580459-65580481 AGGAAGCTCTGCAGGGAGGATGG + Intronic
1130182297 15:81642861-81642883 GTGCGTGTGTGTAGGGAGGAGGG - Intergenic
1130553735 15:84908660-84908682 GTGAGGCTGGGAAGGGAGGAGGG - Intronic
1130955704 15:88626059-88626081 GTGGTGCACTGCAGGGAGGGAGG + Intronic
1131446462 15:92502041-92502063 CTGAGGTTCTGCAGGGAGGAGGG - Intergenic
1132055878 15:98649810-98649832 GGGCGGCTCTGCCGGGAGGGAGG + Intronic
1132313917 15:100877479-100877501 GTGGTGCAGTGCAGGGAGGAGGG - Intergenic
1132737548 16:1394386-1394408 GGTCGGCTCTGCAGAGAGGAGGG - Intronic
1132787990 16:1668818-1668840 GAACAGCTCTGCAGGGAGGCAGG - Intronic
1132897252 16:2234922-2234944 GTGCGGGTCTTCCGTGAGGACGG - Exonic
1132954678 16:2585426-2585448 GTGCGGCCCTGCAGGGAGGGAGG - Intronic
1133055591 16:3144121-3144143 CTGGGGCTCAGCAGGGAGGCAGG - Intergenic
1133109883 16:3541686-3541708 GCCGGGCTCTGCAGGGAGGAAGG - Intronic
1133247843 16:4461179-4461201 GACAGGCTCTGCAGGGAGGCGGG - Intergenic
1133249182 16:4469141-4469163 CTCCGACTCTGCAGGGAGGTTGG - Intronic
1133388012 16:5386403-5386425 GCGTGGCTCAGCAGTGAGGATGG - Intergenic
1133989680 16:10694870-10694892 GTGGGGCTCATGAGGGAGGATGG - Exonic
1136408558 16:30063895-30063917 GAAAGGCTCTTCAGGGAGGAGGG - Exonic
1136620847 16:31427706-31427728 CTGCGGCTCTGTGGGGAGGGCGG - Intergenic
1137552688 16:49451438-49451460 GTGAGAGTCTGCAGGCAGGAAGG - Intergenic
1137641279 16:50032521-50032543 TTTTGCCTCTGCAGGGAGGAAGG + Intronic
1138199825 16:55080427-55080449 TTACGACTCTGCAGGGATGAGGG + Intergenic
1138656194 16:58492909-58492931 TGGTGGCTCTGCAGGGAGGAGGG - Intronic
1141503762 16:84461829-84461851 CAGCAGCTCTGCAGCGAGGAGGG - Intronic
1141592986 16:85081038-85081060 GGGCTGCGCTGCAGGCAGGAGGG - Intronic
1141611339 16:85182707-85182729 GTGCAGGTCTTCAGGGAGGCAGG + Intronic
1141882970 16:86872097-86872119 GTACGGCTCTGCAGGCAGCTGGG - Intergenic
1141898448 16:86973942-86973964 ATGCTGCTCTGAAGTGAGGATGG - Intergenic
1142119580 16:88379387-88379409 GGGGTGCTCTGCAGGGAGCAGGG - Intergenic
1143177861 17:4966988-4967010 GCGCGGCCCTGCAGGGCGGTGGG - Intronic
1144117421 17:12111960-12111982 GTGCAGCTCTGTAGGGAGTATGG + Intronic
1144665458 17:17099025-17099047 GAGGGGCTTTGGAGGGAGGAGGG + Intronic
1144756857 17:17685164-17685186 GTGTGGCTCCACAGGGAGGGAGG + Intronic
1145304965 17:21668960-21668982 CTGGGGGTCTGCAGGGAGGTCGG + Intergenic
1146265676 17:31451063-31451085 GTGCGGCTCTGCTGGGACTGGGG - Intronic
1147133892 17:38424416-38424438 GTCAGACTGTGCAGGGAGGAGGG - Intergenic
1147558909 17:41497085-41497107 GTCGGGTTCTGGAGGGAGGAGGG - Intergenic
1147564834 17:41529710-41529732 GTGGGGCTGTGTGGGGAGGAAGG - Intergenic
1147905968 17:43823270-43823292 GTGGGGCTTTGAGGGGAGGATGG - Intronic
1147976845 17:44252908-44252930 GGGCGTCTGAGCAGGGAGGAAGG - Intronic
1149637953 17:58185404-58185426 CTGAGGGTGTGCAGGGAGGAGGG - Intergenic
1150005069 17:61464140-61464162 GTGCGTGCCTGGAGGGAGGAGGG - Intronic
1150385383 17:64755288-64755310 GGGAGGCTCAGGAGGGAGGATGG + Intergenic
1150475398 17:65471003-65471025 GGGAGGCTCTGCCTGGAGGAAGG - Intergenic
1150637878 17:66928903-66928925 GTCCGGCTCTGCAAGGAGCCTGG - Intergenic
1150710146 17:67524201-67524223 GTGAGGCTGTGGCGGGAGGATGG + Intronic
1150770951 17:68040332-68040354 GGGAGGCTCAGGAGGGAGGATGG - Intronic
1151201016 17:72468082-72468104 GTGCGTGTCTGGAGGGCGGAGGG - Intergenic
1151755818 17:76074768-76074790 GTGCGACTCTGCCGGGCTGAAGG - Intronic
1152116102 17:78388273-78388295 GTGGGTCTCCGCAGGTAGGACGG + Intronic
1152210786 17:79001958-79001980 GTGGGGCTGGGGAGGGAGGAGGG - Intronic
1152525328 17:80885046-80885068 GGGCAACTCTGCAGAGAGGACGG + Exonic
1153339753 18:3961603-3961625 GTGAGGTTTTGCTGGGAGGAGGG - Intronic
1155168236 18:23248107-23248129 CTGCGGCTCTGGAGGGGGCAAGG - Intronic
1155368382 18:25072050-25072072 GTCCGGCTGTGCCGGGAGGTAGG + Intronic
1156651964 18:39235594-39235616 GGGGGGCCGTGCAGGGAGGAAGG - Intergenic
1157148672 18:45192101-45192123 TTGCTACTCTGCAGGGAAGAGGG - Intergenic
1157826600 18:50818013-50818035 GGGAGGCACTGCAGGCAGGAAGG - Intronic
1158329401 18:56344896-56344918 GGGGATCTCTGCAGGGAGGAAGG + Intergenic
1158876085 18:61735874-61735896 GTGCAGCTTGGGAGGGAGGAGGG - Intergenic
1160024027 18:75204397-75204419 GTGGGGCTCTGCTGGGAGCTGGG + Intronic
1160237247 18:77095673-77095695 CTGCTGTTCTCCAGGGAGGATGG + Intronic
1160696982 19:489516-489538 CCTCGGCTCTGCAGGGAGGACGG - Intronic
1160812615 19:1019490-1019512 CTGGGGGGCTGCAGGGAGGAAGG + Intronic
1160939093 19:1611842-1611864 GTTCCGCTCTGGAGGGAGGGGGG + Exonic
1161062094 19:2220265-2220287 CTGCTGCTCTTCAGGCAGGAGGG + Intronic
1161297220 19:3526198-3526220 GTGGGGGCCTGCAGGGCGGATGG - Intronic
1161771422 19:6233152-6233174 GTCCGGCACTGCAGGCAGGCTGG - Intronic
1161950291 19:7463975-7463997 GGGCGGCCCTGGAGGCAGGAGGG - Intronic
1162185255 19:8899974-8899996 GTGGGGCTGGGGAGGGAGGATGG + Exonic
1162186055 19:8905986-8906008 GTGGGGCTGGGGAGGGAGGATGG + Exonic
1162471131 19:10872319-10872341 GGCCGCCTCTGCAGGGAGGAGGG + Intronic
1162755783 19:12858750-12858772 CTGCGGGGCTGCAGGGAAGATGG + Intronic
1163641444 19:18464702-18464724 GTGCCGGGCTTCAGGGAGGAGGG - Intronic
1163691696 19:18742016-18742038 GTGGGGCTGGGCAGGCAGGAAGG - Intronic
1164631734 19:29766269-29766291 GAGTGTCACTGCAGGGAGGAGGG - Intergenic
1165258777 19:34596246-34596268 CTGTGGCTGAGCAGGGAGGATGG + Exonic
1165924930 19:39320908-39320930 CTGCGGCTCGGGAGGGAGGGCGG - Intergenic
1166118916 19:40673367-40673389 GTGCGGCGCTGCAGCGTGGATGG + Exonic
1166230368 19:41422931-41422953 GTGGGGGTCAGGAGGGAGGATGG - Intronic
1166892207 19:46000545-46000567 GGGAGGTTCTGCAGAGAGGAGGG + Intronic
1167486578 19:49766674-49766696 TAGCGGCTCTCCAAGGAGGAAGG - Intergenic
1167502862 19:49857310-49857332 GGGCGGCTCTGCAGGGCTGGAGG + Intronic
925360714 2:3278440-3278462 GAGCAGCTCTGCACGGAGGGAGG - Intronic
925580411 2:5404617-5404639 GGGCTGCTCTGCAGTCAGGAGGG + Intergenic
925905963 2:8539806-8539828 CTGGGGCCCTGCAGCGAGGACGG - Intergenic
927289628 2:21393011-21393033 GAGAGGCTCTGCACCGAGGAAGG + Intergenic
927990482 2:27443497-27443519 GTTGGGCCCTGCAGGAAGGACGG + Exonic
929170397 2:38926685-38926707 CTGGGGTTCTGCAGGGAGGAAGG + Intronic
929339792 2:40801504-40801526 GTGGAGCTATGAAGGGAGGAAGG - Intergenic
929557877 2:42936787-42936809 CTGCAGCTCGGCTGGGAGGAGGG + Intergenic
930716313 2:54596824-54596846 TTGCCTCTCTGTAGGGAGGAGGG + Intronic
931430333 2:62203883-62203905 ATGCGATTCTGCAGGGAGGTGGG - Intronic
931888709 2:66646499-66646521 GTGTGTCTCTGCAGGTGGGATGG + Intergenic
932048636 2:68376901-68376923 GTGGGGGACTGCAGGGAGGTGGG - Intronic
933669057 2:84989525-84989547 GGATGGATCTGCAGGGAGGAAGG + Intronic
934856088 2:97731280-97731302 GTGCAGCTTTCCAGTGAGGAGGG - Intronic
935278461 2:101496497-101496519 TTGGGCCTCTGCAGGGTGGAGGG - Intergenic
935332052 2:101984623-101984645 GTGCTGCTCGCCAGGGTGGAGGG - Intergenic
935578674 2:104736682-104736704 GGGAGGCTATGCTGGGAGGATGG + Intergenic
935595490 2:104874160-104874182 CTGCGGGTCTCCTGGGAGGAAGG + Intergenic
936059862 2:109287525-109287547 GGGTGGCTCTGCAGGGTGCATGG - Intronic
936830895 2:116645050-116645072 GTGCTGCACTGCAGGGAAGCTGG - Intergenic
937055239 2:118929144-118929166 GTGAGGCTCTGATGTGAGGAGGG - Intergenic
937356331 2:121200220-121200242 GTGTGGCACTCCAGGGAGGCTGG + Intergenic
938405382 2:131030005-131030027 GTGAGGCTGTGCAGGGCTGATGG + Intronic
941064972 2:160891740-160891762 GTGGTGCTGTTCAGGGAGGAGGG - Intergenic
943927149 2:193799657-193799679 TTGTGTCTATGCAGGGAGGAGGG - Intergenic
946190062 2:218003284-218003306 GCGGGGGTCTGCAGTGAGGAGGG - Intergenic
946996602 2:225399726-225399748 GCTCGGCTGTGCAGGGAGGGTGG + Intergenic
947602674 2:231464259-231464281 GCGCGGCGCCGCGGGGAGGAGGG - Intronic
948115361 2:235491407-235491429 CGGAGGCTGTGCAGGGAGGATGG - Intergenic
1168954030 20:1821661-1821683 GTGAATGTCTGCAGGGAGGAAGG - Intergenic
1171021049 20:21584426-21584448 GTGGGGCTCCCCAGGGAAGATGG - Intergenic
1171229776 20:23475169-23475191 GTGGGGCTCTGAAGGGTGCAAGG - Intergenic
1171239369 20:23552419-23552441 GTGGGGCTCTGGAGAGAGCACGG - Intergenic
1171415802 20:24979703-24979725 GTGGGGCTCTGAATAGAGGAAGG - Intronic
1171447476 20:25214970-25214992 GTGGGGCTGTGCAGTGAGGTGGG + Intronic
1171452843 20:25248051-25248073 CTGCGGCTCTGCGGGCGGGATGG - Exonic
1172463698 20:35138992-35139014 TTCCCCCTCTGCAGGGAGGAGGG - Intronic
1173656618 20:44704178-44704200 GGGAGGCTCTGCAGAGAGCAGGG + Intergenic
1174084170 20:47993521-47993543 GTGAGGTCCTGCAGGGAGGCTGG + Intergenic
1175733063 20:61367116-61367138 GTGCAGGTCCTCAGGGAGGAGGG + Intronic
1175825644 20:61935097-61935119 CTGTGGCTCTGCAGGGATCACGG + Intronic
1175913499 20:62415389-62415411 GTGCAGCTCAGCAGTGAGCAGGG - Intronic
1175922422 20:62456351-62456373 CTGCCCCTCTGCAGGGAGCAAGG - Intergenic
1176139982 20:63540753-63540775 TTGGCGCTCTGCAGGGAGGAGGG + Intergenic
1176196809 20:63840713-63840735 GTGCCCCTCTGGAGGGAGGTGGG + Intergenic
1176656285 21:9591409-9591431 CTGGGGATCTGCAGGGAGGTCGG + Intergenic
1179006663 21:37521293-37521315 GAGTGTCTCTGCAGGGAGTAGGG - Intergenic
1179022893 21:37656181-37656203 GTGCTGCTCAGCAGGGAGAAGGG - Intronic
1179603908 21:42499648-42499670 GTGCGGCTCTGCAGGGAGGAGGG + Intronic
1179708436 21:43195626-43195648 GAGCAGCGCTTCAGGGAGGAGGG + Intergenic
1181086266 22:20440872-20440894 GTGCAGCCCTGCAGTGAGGCTGG + Intronic
1181310867 22:21944033-21944055 GTGGCACTCTGCAGGGAGCAGGG - Intronic
1181602641 22:23961342-23961364 GTGCGTCCCTACAGGGAGGGCGG + Intergenic
1181605873 22:23979965-23979987 GTGCGTCCCTACAGGGAGGGCGG - Intronic
1181745536 22:24952957-24952979 CTCCGGGTCTGCAGGGAGGGAGG + Intronic
1184065335 22:42115713-42115735 GTGCGGTTTCGAAGGGAGGAAGG + Intergenic
1184226479 22:43131667-43131689 TTGCAGCGCTGCAGGAAGGATGG - Intergenic
1184835651 22:47019553-47019575 GTGTGGGTGTGCAGGGAGGGAGG + Intronic
1185070667 22:48654111-48654133 CCGCGGCTCTGGAGGGAAGAGGG + Intronic
1185224021 22:49643001-49643023 GTCTGGATCTGCAGGCAGGAGGG - Intronic
950113843 3:10438027-10438049 CTGAGGCTCTGCAGGGAGCCAGG + Intronic
950263596 3:11559448-11559470 GGCCGGTTCTGCGGGGAGGAGGG + Exonic
950889874 3:16394270-16394292 GGGAGGCTGAGCAGGGAGGATGG + Intronic
952980121 3:38727536-38727558 CTGTGGCTCTGCAGGGATGGTGG + Intronic
961282640 3:125775690-125775712 GTGCAGCTCTGGAGGGGGGCAGG + Intergenic
961378469 3:126482294-126482316 GTGAGGATCGCCAGGGAGGAAGG + Exonic
962259728 3:133895123-133895145 GTGCGGCGCTGCAGGGGGCCCGG - Intronic
968534043 4:1112873-1112895 GTGGGGGGCTGCAGGGAGGAAGG - Intronic
969015096 4:4098742-4098764 GTGCAGCTCTGGAGGGGGGCAGG - Intergenic
969461828 4:7333113-7333135 GTGTGGCCGTGCAGGCAGGAAGG + Intronic
971437104 4:26639297-26639319 GGGAGGCTCTGGTGGGAGGATGG - Intronic
972221370 4:36959527-36959549 TTGGGGCTCTGCCAGGAGGAAGG - Intergenic
974209404 4:58750074-58750096 GTGTGTCTTTGCAAGGAGGATGG - Intergenic
974302296 4:60083537-60083559 GTGTGTCTTTGCATGGAGGATGG - Intergenic
975035681 4:69677320-69677342 GTGAGGGGCTGGAGGGAGGAAGG + Intergenic
975395589 4:73869891-73869913 GTGTGGCTCTGCAGAGGGAAGGG - Exonic
975409904 4:74038169-74038191 GTGTGGCTCTGCAGAGAGAAGGG + Exonic
975415294 4:74098677-74098699 GTGTGGCTCTGCAGAGAGAAGGG + Exonic
978401657 4:108337398-108337420 GTGGGGCTCTTCAGGAAGAAAGG - Intergenic
979041995 4:115810133-115810155 GTGAGGGTCTGCGGGGAGGGTGG + Intergenic
981631648 4:146825997-146826019 GTGTGTCTCTGCAGGTAAGATGG + Intronic
984624873 4:181995968-181995990 CTGGGGCTCTTGAGGGAGGAAGG - Intergenic
984669122 4:182462480-182462502 GTGCGGCTGTTCAGAGAGGAGGG - Intronic
985875465 5:2591045-2591067 CTGAGGCTCTGCAGACAGGAGGG + Intergenic
992215260 5:74519182-74519204 GGGCAGCTCTGCAGGGAGTGTGG - Intergenic
997591154 5:135073087-135073109 GTGCTGCTATGCAGAGAGGAGGG - Intronic
998013826 5:138716631-138716653 GTGAGCCTCTGTAGGGAGAATGG + Intronic
999204909 5:149840848-149840870 ATGTGGCACTTCAGGGAGGAGGG + Intronic
999254738 5:150204041-150204063 GAGTGGCGCTACAGGGAGGATGG + Intronic
999737123 5:154521236-154521258 GCGCTGCTCTGGAGGGAGCAGGG - Intergenic
1001883109 5:175261951-175261973 GTGCGACTCACCAGGAAGGAAGG - Intergenic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1002009797 5:176269848-176269870 GGGAGGCTCAGAAGGGAGGACGG - Intronic
1002193194 5:177489486-177489508 GTGCGGCTCTGCAGCGGCGTGGG + Exonic
1002365485 5:178706417-178706439 CTGCGGCTCTGCTGGGATGGTGG + Intergenic
1002581789 5:180213050-180213072 GTGCGGGTCCTCAGGGAGGAAGG + Intergenic
1002584332 5:180232571-180232593 GTGGGGGTTTTCAGGGAGGAGGG - Intergenic
1002756390 6:164537-164559 ATGCTGCTCTGCAGTGATGAGGG + Intergenic
1003282432 6:4705689-4705711 GTGCAGGGGTGCAGGGAGGATGG - Intergenic
1004193962 6:13487664-13487686 GCGCGGCGCTGCAGCGAGGGCGG - Intergenic
1006006903 6:31009994-31010016 GTGCTGCTCTGCAGCTGGGAAGG + Intergenic
1006092018 6:31633749-31633771 GTGCGTTTCTGCAGGGAGCAAGG + Intronic
1007175179 6:39891505-39891527 GTGGGGCTCTGCCAAGAGGAAGG + Intronic
1007246993 6:40470132-40470154 GTGGGGTTCTGCAGGCAGGATGG - Intronic
1007742384 6:44020807-44020829 GTGGGGCTCTGAAGGAAGGAAGG + Intergenic
1008286294 6:49655268-49655290 CAGAGGCTCTGCAAGGAGGAAGG - Intergenic
1010024654 6:71201288-71201310 GTTCTCCTCTGCAGGCAGGAGGG + Intergenic
1014071260 6:117183934-117183956 GTGCGTCTCTGCAGGTGAGATGG - Intergenic
1014077017 6:117246869-117246891 GTGCGTCTCTGCAGGTGAGATGG - Intergenic
1015570833 6:134619708-134619730 GTGAGGAGATGCAGGGAGGATGG + Intergenic
1015734005 6:136377971-136377993 ACCAGGCTCTGCAGGGAGGATGG + Intronic
1018977228 6:168574743-168574765 GTGCCGGTCTTCAGGGAGGTCGG - Intronic
1019156693 6:170044030-170044052 GTGTGGCGTTGCAGGGAGAAGGG - Intergenic
1019462241 7:1166607-1166629 GCACGACTCTGCAGGGAGGCGGG + Intergenic
1019571827 7:1716434-1716456 CTAAGGCTCTGGAGGGAGGATGG - Intronic
1019748623 7:2714780-2714802 GTGAGACTCTCCATGGAGGAGGG + Exonic
1019772935 7:2895051-2895073 ATCTGGGTCTGCAGGGAGGAGGG + Intergenic
1019996152 7:4725621-4725643 GTGTGGCTGTGTTGGGAGGACGG + Intronic
1022715312 7:32892565-32892587 AAGCGGCTCTGGAGAGAGGAGGG - Intronic
1028148927 7:87349918-87349940 GTGAGCCTCTTCAGGGAGTAAGG + Intronic
1029170528 7:98626733-98626755 GTGCCGCTGCGCAGGGAGGACGG + Intronic
1029889830 7:103915890-103915912 TTTCTGCTCTGCAGAGAGGAAGG - Intronic
1030605340 7:111633649-111633671 GTGCAGCACACCAGGGAGGAGGG - Intergenic
1032166836 7:129552184-129552206 GCACTGCTCTGCAGCGAGGATGG + Intergenic
1033036674 7:137882102-137882124 GTGTGGCTTGGAAGGGAGGATGG + Intronic
1033174783 7:139113964-139113986 CTGAGGCTCTGCAGGGAGGAAGG + Intergenic
1033339219 7:140479083-140479105 CTGCGGCGCGGGAGGGAGGAGGG - Intronic
1034436357 7:151064511-151064533 GCGGTGGTCTGCAGGGAGGAGGG - Exonic
1035140261 7:156752572-156752594 GAGGGGAGCTGCAGGGAGGAGGG + Intronic
1035309254 7:157954696-157954718 CTGGGGCTCGGCAGGGAGGCGGG - Intronic
1035369263 7:158368664-158368686 GGGGGGCTCCCCAGGGAGGAAGG + Intronic
1035554316 8:554833-554855 GTGTGGCTCTGCAGGTGGTAGGG - Intergenic
1036391727 8:8329794-8329816 CTGCTGCTCCACAGGGAGGAGGG + Intronic
1036897916 8:12650528-12650550 GTGCAGCTCTGGAGGGGGGCAGG - Intergenic
1037281850 8:17250056-17250078 GTGAGGGTCTTCAGGGCGGAAGG + Intronic
1037521054 8:19681176-19681198 TGGGGGCTCTGCAGGGAGGTGGG - Intronic
1037607181 8:20447820-20447842 GTGAGGCCCTGTAGGGAGGTAGG - Intergenic
1037767850 8:21782851-21782873 TCGGGGCCCTGCAGGGAGGAAGG + Exonic
1037857708 8:22383630-22383652 GTGCTGGCCTGCAGGGAGGCTGG + Intronic
1039412070 8:37363237-37363259 GTGCACCTCTCCAGGGAGGCAGG + Intergenic
1039884933 8:41649386-41649408 GTGAGGCTCTGCTGGGAGGCAGG - Intronic
1039914720 8:41851482-41851504 GTGAGGCCCAGCAGGCAGGAAGG - Intronic
1040915546 8:52564314-52564336 GGGCAGCGCTGGAGGGAGGAGGG - Intronic
1041721888 8:60983612-60983634 GTGAGGTTTTGCAGGGAGAAGGG + Intergenic
1042807494 8:72787290-72787312 GTGGGGCTGAGCTGGGAGGATGG + Intronic
1044722814 8:95167445-95167467 ATGCGGCTCTGCAGGGAAGGGGG - Intergenic
1049441771 8:142612872-142612894 GTGGAGCCCTGCAGGGGGGAGGG + Exonic
1049688378 8:143948311-143948333 GAGCGGCTGTGCAGTGGGGAAGG + Intronic
1051327704 9:15990679-15990701 GTGTGGCTCTGCATGTAAGATGG - Intronic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057845770 9:98521309-98521331 GTGCGGTGCTGCAGGGAGGGTGG + Intronic
1058758150 9:108102926-108102948 CTGCTGCTTTGCAGAGAGGAAGG + Intergenic
1059036876 9:110763690-110763712 GTGTGCCTGTGCAGGGAGGGAGG + Intronic
1059437084 9:114283525-114283547 GTGGGGAACTCCAGGGAGGAGGG + Intronic
1059820206 9:117964027-117964049 TTGCAGCTATGCTGGGAGGAAGG + Intergenic
1060554553 9:124501564-124501586 GTGGTGCTCAGCAGGGATGATGG + Intronic
1061250976 9:129426211-129426233 GAGCGGCTGTGCAGGGTGGATGG + Intergenic
1061287055 9:129629858-129629880 GGGAGGCTGAGCAGGGAGGATGG + Intronic
1061485798 9:130919959-130919981 GTGCGGCAGGGCAGGGAGGCTGG + Intronic
1061544200 9:131294472-131294494 GTGCTGCTCGGGAGGGAGAAGGG - Intronic
1061618343 9:131794558-131794580 GACCCCCTCTGCAGGGAGGAGGG + Intergenic
1061912969 9:133734697-133734719 GTGAGGCCGGGCAGGGAGGATGG + Intronic
1062449859 9:136610877-136610899 GTGCGGCCAGGCAGGGAGGGCGG + Intergenic
1062449874 9:136610913-136610935 GTGCGGCCAGGCAGGGAGGGCGG + Intergenic
1062496491 9:136833874-136833896 GGACGGCTCTGCAGGAAGGAGGG - Intronic
1062567758 9:137170829-137170851 GTGAGGGCCTGCAGGGAGGACGG + Intronic
1062573220 9:137194952-137194974 GGGAGGCTCTGCTGGGAGGCTGG - Intronic
1062624381 9:137436269-137436291 GGGCGGCTCTGCAGAGGGCAGGG + Exonic
1062653462 9:137590217-137590239 GTGCGGCTCGGCCGGGTGGCCGG - Exonic
1062657884 9:137613560-137613582 GGTGGGCTCTGCAGGGTGGAAGG + Intronic
1203490784 Un_GL000224v1:102750-102772 GGGCGGCGCTGCTGGGAGGGCGG + Intergenic
1203503408 Un_KI270741v1:44628-44650 GGGCGGCGCTGCTGGGAGGGCGG + Intergenic
1203634001 Un_KI270750v1:94891-94913 CTGGGGATCTGCAGGGAGGTCGG + Intergenic
1186720672 X:12300365-12300387 GTAAGGCTCTGGAGGCAGGATGG + Intronic
1187299373 X:18032884-18032906 TTATGGCTCTGCAGGGAGAAGGG + Intergenic
1192409935 X:70925145-70925167 GTTTGGCACTGCTGGGAGGAGGG - Intergenic
1196892865 X:120307876-120307898 GTGGGGCACTGCAGAGAGGGAGG - Intronic
1197969187 X:132097119-132097141 GTGAGGATCTGGAGAGAGGATGG - Intronic
1198241672 X:134794043-134794065 GGGAAGCTCTGCAGAGAGGACGG - Intronic
1199265441 X:145821630-145821652 GTGCGATTCTGTAGGGAGGTCGG - Exonic
1200062203 X:153488674-153488696 GGGCGGCCAGGCAGGGAGGAGGG - Intronic
1200174445 X:154103087-154103109 GTGCGTCTCTGCGGGGAGAAAGG + Intergenic