ID: 1179606568

View in Genome Browser
Species Human (GRCh38)
Location 21:42519611-42519633
Sequence CTGCCAGGGGGTTGGCGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 629
Summary {0: 1, 1: 0, 2: 5, 3: 56, 4: 567}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179606568_1179606583 18 Left 1179606568 21:42519611-42519633 CCTCCACGCCAACCCCCTGGCAG 0: 1
1: 0
2: 5
3: 56
4: 567
Right 1179606583 21:42519652-42519674 TTCTCAGCCCTGCTGGTTGGTGG 0: 1
1: 0
2: 0
3: 16
4: 249
1179606568_1179606581 11 Left 1179606568 21:42519611-42519633 CCTCCACGCCAACCCCCTGGCAG 0: 1
1: 0
2: 5
3: 56
4: 567
Right 1179606581 21:42519645-42519667 GTGCAGCTTCTCAGCCCTGCTGG 0: 1
1: 0
2: 2
3: 21
4: 285
1179606568_1179606586 30 Left 1179606568 21:42519611-42519633 CCTCCACGCCAACCCCCTGGCAG 0: 1
1: 0
2: 5
3: 56
4: 567
Right 1179606586 21:42519664-42519686 CTGGTTGGTGGAGCATCCACAGG 0: 1
1: 0
2: 0
3: 8
4: 125
1179606568_1179606582 15 Left 1179606568 21:42519611-42519633 CCTCCACGCCAACCCCCTGGCAG 0: 1
1: 0
2: 5
3: 56
4: 567
Right 1179606582 21:42519649-42519671 AGCTTCTCAGCCCTGCTGGTTGG 0: 1
1: 0
2: 0
3: 24
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179606568 Original CRISPR CTGCCAGGGGGTTGGCGTGG AGG (reversed) Intronic
900213664 1:1469474-1469496 CAGCCATGGGGTGGGGGTGGGGG + Exonic
900221225 1:1510279-1510301 CAGCCATGGGGTGGGGGTGGGGG + Intergenic
900284978 1:1894685-1894707 CTGCCAGGGAGAGGGCGGGGTGG - Intergenic
900298260 1:1963777-1963799 CTGCAAGCTGGTGGGCGTGGAGG - Exonic
900336526 1:2166736-2166758 CAGCCTGGGGGTGGGGGTGGGGG - Intronic
900423864 1:2567405-2567427 CTGCCGGGAGGTTGGGGTGTGGG - Intergenic
900568635 1:3347548-3347570 CAGTCAGGGGGTGGGGGTGGGGG + Intronic
900577640 1:3391400-3391422 CTGACAGGTGGTTTGCGTAGCGG - Intronic
900803992 1:4755533-4755555 CAGGCAGGGGGTGGGGGTGGGGG - Intronic
900999136 1:6139091-6139113 CTGCCAGGGGCTCGAGGTGGTGG + Intronic
901212422 1:7534115-7534137 CTGCCAGGGGCCTGGCGGGCGGG - Intronic
901768022 1:11516035-11516057 CTTCCAGGTGGGTGGCCTGGCGG - Exonic
901823318 1:11844360-11844382 ATGGCAGGGGGTTGAGGTGGGGG - Intergenic
902455481 1:16530801-16530823 GTGGCAGGGGGTGGGGGTGGGGG + Intergenic
903188867 1:21645325-21645347 CTGCCAGGGGCTGGGCATGGTGG + Intronic
903205616 1:21780377-21780399 TTGCCAGGGGCTGGGCGAGGGGG + Intronic
903647078 1:24902202-24902224 CGGCCAGAGTGATGGCGTGGAGG - Exonic
904042652 1:27593402-27593424 CTGCCTGGGGGTAGTGGTGGCGG - Intronic
904208837 1:28872357-28872379 CTGCCCGGGGGTAGGAGTTGGGG + Intergenic
904348253 1:29887885-29887907 CTGTCAGGGGGTTGGGGGGTAGG + Intergenic
904466178 1:30708905-30708927 TTGGCAGGGGGTGGGGGTGGGGG - Intergenic
904503299 1:30930149-30930171 ATGCGAGGGGGTGGGCATGGGGG - Intergenic
905011041 1:34747429-34747451 CTCCAAGGGGTTTGGGGTGGGGG - Intronic
905298020 1:36966763-36966785 ATGCCAAGGGGTTGGGGGGGTGG - Intronic
906132495 1:43468961-43468983 GTGGCAGGGGGCTGGCGTGTTGG + Intergenic
906252951 1:44325360-44325382 CAGCCAGGGGCCGGGCGTGGTGG - Intronic
906400363 1:45499917-45499939 CTGGCACAGGTTTGGCGTGGTGG - Intronic
906421272 1:45669618-45669640 TTGGCAGGGGGTTGGAGGGGGGG - Intronic
906467620 1:46097598-46097620 TAGCCAGGGGCTGGGCGTGGTGG + Intronic
906814478 1:48864882-48864904 AAGCCAAGGGGTTGGCATGGGGG + Intronic
907051059 1:51330290-51330312 CTGCCAGGGGCCGGGCGGGGTGG + Intronic
907480454 1:54742336-54742358 CTCCCGGGGGGATGGGGTGGGGG - Exonic
907905734 1:58782783-58782805 CTGGGTGGGGGTCGGCGTGGTGG + Exonic
910757242 1:90706679-90706701 CAGCCAGGGATTTGGCGCGGCGG - Intergenic
910839303 1:91546434-91546456 CTGCCAGGGACTCGGCGTGGGGG - Intergenic
911619435 1:100050180-100050202 TTGGGAGGGGGGTGGCGTGGAGG + Intronic
912631156 1:111247856-111247878 CTGGAAAGGGGTTGGGGTGGGGG - Intergenic
912785830 1:112603000-112603022 CTGCCAGGGGCCGGGCGCGGTGG - Intronic
912883491 1:113444136-113444158 CTGCCATGGGGCTGGGGTAGTGG - Intronic
913278698 1:117164349-117164371 CTGGCAGGGGGGTGGGGTTGCGG + Intronic
913986000 1:143566722-143566744 CAGCCAGGCGGTTTGCATGGCGG - Intergenic
914772574 1:150702738-150702760 CTGTCAGGGGGTTGGAGGGAGGG + Intronic
914886276 1:151586918-151586940 CTCTCAGGGGCTGGGCGTGGTGG + Intergenic
916072314 1:161177447-161177469 CTGCCCGGCTGTTGGGGTGGCGG - Exonic
916575047 1:166059652-166059674 GTGCAAGGTGGTTGGGGTGGAGG + Intronic
916901771 1:169232544-169232566 CAGCCAGGGTGTTGGGGGGGGGG + Intronic
917110180 1:171539551-171539573 CTGCCAGGGGCTAGGAGTAGGGG - Intronic
917212516 1:172644833-172644855 ATGGCAGGGGTTTGGGGTGGAGG - Intergenic
918145311 1:181750971-181750993 CTGTCAGGGGGGTGGGGTAGGGG + Intronic
919027650 1:192198438-192198460 CTGCCTAGGGGTGGGGGTGGGGG + Intergenic
920087115 1:203425570-203425592 GTGCAAAGGGGTTGGTGTGGAGG + Intergenic
920253953 1:204641735-204641757 CAGCCAGGTAGTTGGTGTGGTGG - Intronic
920338552 1:205260688-205260710 CTGCCAGGGGGCTGGGGTGGGGG - Intronic
920512173 1:206559437-206559459 CTGGGATGGGGTTGGTGTGGGGG + Intronic
920891101 1:209986316-209986338 CTGCCAGGGGCTGGGCGCGGTGG + Intronic
921338457 1:214111072-214111094 GTTCCAGGGGCTTGGGGTGGTGG - Intergenic
921509983 1:216016187-216016209 CTGCTGGGGGGTGGGCGGGGAGG + Intronic
922516419 1:226211410-226211432 CTGCCAGGGGCCTGGCCAGGTGG + Intergenic
923341615 1:233012338-233012360 ATGCCTGGGGATTGGGGTGGAGG - Intronic
923625504 1:235610795-235610817 CTGCAAGAGGCTGGGCGTGGTGG + Intronic
924091984 1:240510453-240510475 TTGCCAGGGGCTGGGGGTGGAGG + Intronic
1063463601 10:6229509-6229531 CTGCAAGGGGGTGGCTGTGGGGG - Intronic
1063665899 10:8060394-8060416 CTGGCAGGGGCTGGGCTTGGGGG + Intronic
1065213800 10:23430437-23430459 CTCCCAGGGTCTTGGTGTGGTGG - Intergenic
1065766212 10:29032153-29032175 CTGTCAGTGGGTTGACCTGGAGG - Intergenic
1066191743 10:33062237-33062259 CTTCCAGCGGGTGGGGGTGGAGG + Intergenic
1067048183 10:42997573-42997595 CTGGCAGTGGGATGGCCTGGGGG + Intergenic
1067054687 10:43043806-43043828 CTGCCAGGGAGCTGAAGTGGAGG + Intergenic
1067091145 10:43266470-43266492 CTGCCCGGGGCCTGGCGTGGGGG - Intronic
1067902599 10:50257904-50257926 CTGAGAGGAGCTTGGCGTGGAGG + Intergenic
1068380173 10:56242869-56242891 CTGGCTGGGGCTGGGCGTGGTGG - Intergenic
1069020052 10:63476347-63476369 CTGCTAAGGTGTTAGCGTGGAGG - Intergenic
1069533345 10:69234973-69234995 GTTCCAGGGGCCTGGCGTGGTGG + Intronic
1069699602 10:70412388-70412410 CGGCCGGGGGGTGGGGGTGGGGG + Intronic
1069715539 10:70518822-70518844 CTGCCAGGGGGCAGGGGTCGGGG - Intronic
1069901726 10:71710444-71710466 CTTCCTGGAGGTTGGGGTGGGGG - Intronic
1069902439 10:71713786-71713808 CTTCCTGGAGGTTGGGGTGGGGG - Exonic
1070101771 10:73394704-73394726 CTGTCGTGGGGTTGGGGTGGTGG + Intronic
1071525242 10:86354539-86354561 CTGCCTTGGGGTTGTGGTGGTGG - Intronic
1071997827 10:91163882-91163904 CTGCCCGAGTGTTGGCGGGGAGG - Intronic
1072637820 10:97188579-97188601 CTTCCAGGGGGTTGCCCTGCTGG - Intronic
1073363415 10:102918203-102918225 CAGCCAGGGGGCTGGAATGGGGG - Intergenic
1074301891 10:112240632-112240654 GCGGCAGGGGGTTGGCGTGTCGG + Intergenic
1074384435 10:113005691-113005713 CTGCAAAGGGGTTGGCTGGGGGG + Intronic
1075216844 10:120543773-120543795 TTGCCAGGGGCTTGGCGAAGGGG - Intronic
1075608272 10:123831955-123831977 GTGCCAGGGGGTGGGGGTTGTGG + Intronic
1076533289 10:131159684-131159706 CTGCCATGGGGTGGGGTTGGGGG - Intronic
1076876424 10:133218401-133218423 CTGCCACGGGCTTGGCGCAGCGG + Intronic
1077196707 11:1284634-1284656 CAGCCTGGGGGTGGGTGTGGGGG - Intronic
1077329585 11:1978166-1978188 CTGCCTGGGGGCTGCCCTGGTGG - Intronic
1077413462 11:2414011-2414033 CTGCCAGGGGGTGGGGTGGGCGG - Intronic
1077651498 11:3977080-3977102 CTGTCAGGGGCCAGGCGTGGTGG - Intronic
1079248520 11:18770923-18770945 CTGCCTGGGGGGTAGAGTGGGGG + Intronic
1079338587 11:19593152-19593174 TTGCCAGGGGCTGGGGGTGGCGG - Intronic
1079959232 11:26902136-26902158 CTGCCAGGGGGTTGGGGGCTTGG + Intergenic
1080085254 11:28272562-28272584 CTGCCAGGGGGTGTGCGTTCAGG + Intronic
1080284558 11:30594320-30594342 TTGTTAGGGGGTTGGCCTGGTGG + Intergenic
1080441466 11:32298642-32298664 ATGGCAGGGGGTTGGGGTGGGGG + Intergenic
1080653877 11:34243422-34243444 TTGCCAGAGGCTGGGCGTGGTGG - Intronic
1082997069 11:59263089-59263111 CTGCCAGGGGGCTGCTGTGGTGG + Intergenic
1083205659 11:61147244-61147266 CTGAAAGGAGGTTGGGGTGGGGG + Intronic
1083323671 11:61862684-61862706 CAGCCATGGGGTAGGGGTGGGGG - Intronic
1083340321 11:61955088-61955110 CAGCCTGGGGGTGGGGGTGGGGG - Exonic
1083826185 11:65205372-65205394 CTGCCAGGGGGTTTGGGTGTGGG - Intronic
1083857523 11:65400484-65400506 CTGTCAGGGGCTTGGCCTGCTGG + Intronic
1083961492 11:66017171-66017193 CTGCCTGCGGGTGGGCGGGGGGG + Exonic
1083984024 11:66198577-66198599 TTGCCAGGGGTTAGGGGTGGGGG + Intronic
1084161897 11:67354738-67354760 CTGCCAGGAAGTTGGTGAGGGGG - Intronic
1084372491 11:68752965-68752987 TTGCCTGGGGCTGGGCGTGGTGG + Intergenic
1084538253 11:69770935-69770957 ATGGCTGGGGGTTGGGGTGGGGG - Intergenic
1085429552 11:76435895-76435917 CTGCCAAGGGTTTGGAGTTGGGG - Intergenic
1085633478 11:78139457-78139479 CGGCCAGGGGCTGGGCGGGGAGG - Intronic
1085635421 11:78155715-78155737 CTGCAAAGGGCTGGGCGTGGTGG + Intergenic
1085780575 11:79404436-79404458 CTGCCAGGGGATTGGGGAAGGGG + Intronic
1086782810 11:90929075-90929097 CTACCAGGTGGTTGGCGATGGGG - Intergenic
1088647981 11:111932323-111932345 CTGCCAGTGGCCAGGCGTGGTGG - Intronic
1088939173 11:114436449-114436471 TTGCCAGGGGCTGGGAGTGGTGG + Intronic
1089299821 11:117491956-117491978 CTGCCAGGTGGGTGGTCTGGGGG + Intronic
1089367671 11:117931148-117931170 CTGCCTGGGGGATGAAGTGGAGG - Intergenic
1089494863 11:118902796-118902818 CTGCCAGGGGCCGGGGGTGGCGG + Exonic
1089565576 11:119369514-119369536 CTCCCACGGGGTTGGTGGGGAGG + Intronic
1090084638 11:123640532-123640554 GTGGCAGGGGGTTGGGGTGGTGG + Intronic
1090104383 11:123836401-123836423 CTGTCAGGGGGTAGGGGTGAGGG - Intergenic
1090114628 11:123955485-123955507 CTGTCAGGGGGTTGGGTGGGAGG + Intergenic
1090224011 11:125057824-125057846 CAGCCAGGCGGTGGGCGGGGGGG + Intergenic
1090237628 11:125160936-125160958 TTCCCCGGGGGTTGGGGTGGGGG + Intergenic
1090253804 11:125268955-125268977 GTGCCATGGGGGTGGGGTGGAGG + Intronic
1090270475 11:125382404-125382426 CTGCCACGGGGTTGCAGCGGGGG + Intronic
1090784370 11:130036236-130036258 CTATCAGGGGGTGGGAGTGGGGG + Intergenic
1091285706 11:134407608-134407630 CTGCCAGGCACTTGGCGCGGAGG + Intronic
1091343743 11:134839411-134839433 CTGCCGGGGGCTGGGCTTGGGGG - Intergenic
1091343760 11:134839471-134839493 CTGCCGGGGGCTGGGCTTGGGGG - Intergenic
1091343777 11:134839531-134839553 CTGCCGGGGGCTGGGCTTGGGGG - Intergenic
1091343794 11:134839591-134839613 CTGCCGGGGGCTGGGCTTGGGGG - Intergenic
1091343811 11:134839651-134839673 CTGCCGGGGGCTGGGCTTGGGGG - Intergenic
1091343828 11:134839711-134839733 CTGCCGGGGGCTGGGCTTGGGGG - Intergenic
1091343845 11:134839771-134839793 CTGCCAGGGGCTGGGCTTGGGGG - Intergenic
1091343861 11:134839831-134839853 CTGCCAGGGGCTGGGCTTGGGGG - Intergenic
1091343877 11:134839891-134839913 CTGCCAGGGGCTGGGCTTGGGGG - Intergenic
1091343926 11:134840076-134840098 CTGCCAGGGGCTGGGCTTGGGGG - Intergenic
1091343942 11:134840136-134840158 CTGCCGGGGGCTGGGCTTGGGGG - Intergenic
1091343959 11:134840196-134840218 CTGCCGGGGGCTGGGCTTGGGGG - Intergenic
1091343976 11:134840256-134840278 CTGCCAGGGGCTGGGCTTGGGGG - Intergenic
1091343990 11:134840316-134840338 CTGCCAGGGGCTGGGCTTGGGGG - Intergenic
1202812564 11_KI270721v1_random:33345-33367 CTGCCTGGGGGCTGCCCTGGTGG - Intergenic
1091759052 12:3075544-3075566 CTGCCAGTGAGTTGGCTTGCTGG + Intergenic
1091926038 12:4350486-4350508 TTGCCATGTGGCTGGCGTGGTGG + Intronic
1093079123 12:14789034-14789056 GGGCCAGGGGGTCGGCCTGGTGG + Exonic
1096157934 12:49351608-49351630 CTTGCAGGGGCTGGGCGTGGTGG + Exonic
1096429148 12:51529024-51529046 CAGGCAGGGGTTTGGCATGGTGG + Intergenic
1096489463 12:52006038-52006060 CTGCCAGGCGGTAGGAGAGGCGG - Intergenic
1096810860 12:54169019-54169041 CTGACTGGGAGTTGGGGTGGGGG - Intronic
1096847761 12:54417470-54417492 AGGCCAGGGGGGTGGGGTGGGGG + Intronic
1096852656 12:54451332-54451354 CTGAAAGGGGCTGGGCGTGGTGG - Intergenic
1098887653 12:75976471-75976493 GTGGCAGGGGGTTGGCGGGGAGG + Intergenic
1099731038 12:86502328-86502350 TTGCCAGGGGGTTGGGGTGAAGG + Intronic
1101331747 12:103762665-103762687 GTGCCAGGGGTTTGGCCTGGAGG + Intronic
1101609643 12:106279050-106279072 CTGCAAGGGGCTGAGCGTGGTGG - Intronic
1101673622 12:106898480-106898502 CTGCGTGGGGGGTGGGGTGGGGG + Intergenic
1101833555 12:108278408-108278430 CTGCTAGGGGGTTGGGGGCGGGG + Intergenic
1102353744 12:112214864-112214886 CTGCCAGGGGCCGGGTGTGGTGG + Intronic
1102445209 12:112996985-112997007 CTGCCAGTGGATTTGCTTGGTGG + Intronic
1102902600 12:116649875-116649897 CTGCCAGGGGGTGGGGGTGGGGG + Intergenic
1103699682 12:122842617-122842639 GTGCCGCGGGGTTGGCGTGTGGG + Intronic
1103849098 12:123919622-123919644 CTGCCAGGGACTAGGAGTGGGGG - Intronic
1103879803 12:124157381-124157403 CCGCCAGGAGGTGGGAGTGGAGG + Intronic
1103906095 12:124327892-124327914 CTGCCAGGGAGGTGGGGTAGGGG + Intronic
1104087092 12:125485369-125485391 CTGGCAGGGAGTTGTGGTGGCGG - Intronic
1104597761 12:130131679-130131701 CTGTGAGGGGGTGGGGGTGGAGG + Intergenic
1104774054 12:131382017-131382039 CTGCCAGGAGGTGGGCACGGAGG - Intergenic
1104937682 12:132375237-132375259 GTGCCATGGGGATGGCCTGGGGG + Intergenic
1105534570 13:21253077-21253099 TTGCCAGGGGCTGGGGGTGGGGG + Intergenic
1105641133 13:22265868-22265890 CTGACATGGGGTGGGGGTGGGGG + Intergenic
1107540056 13:41381073-41381095 TTGCCAGGGGTTGGGAGTGGGGG - Intergenic
1108470994 13:50766802-50766824 CTGGCAGGGGTGGGGCGTGGGGG - Intronic
1109175243 13:59147209-59147231 CTGTCAGGGGGTGGGGCTGGGGG + Intergenic
1109964425 13:69672804-69672826 CTGTCAGGGGGTGGGGGTGCTGG + Intergenic
1112944518 13:104910811-104910833 CTGCCAGGGGTTGGGGGTGGTGG + Intergenic
1113089028 13:106597901-106597923 CAGCCAGGAGGATGGCCTGGAGG - Intergenic
1113452015 13:110417240-110417262 CTGCCAGGGGCTGGGCGGGATGG - Intronic
1116361662 14:44006022-44006044 CTACTAGAGGGTTGGAGTGGTGG - Intergenic
1116491550 14:45509445-45509467 CTGTCAGGGGGTGGGCGTCTAGG - Intergenic
1116910972 14:50463805-50463827 ATCCCAGGGGGTGGGGGTGGAGG + Intronic
1117828108 14:59724575-59724597 CAGCCTGGGGCTGGGCGTGGTGG + Intronic
1119530977 14:75361196-75361218 TTGCCTGGGGCTGGGCGTGGGGG - Intergenic
1119712038 14:76829381-76829403 CTGCCTGGGGGTCAGCGGGGAGG - Intronic
1119725558 14:76920084-76920106 TTGCCAGGGGGAGGGGGTGGGGG - Intergenic
1119750782 14:77075936-77075958 CTGCCAGGGACTGGGCATGGTGG - Intergenic
1120993629 14:90398351-90398373 GTGCCCGGGGGCAGGCGTGGGGG - Intronic
1121153006 14:91654474-91654496 TTGCCATGGGCTTGGGGTGGTGG + Intronic
1121571905 14:94952646-94952668 CAGGCAGGAGGTTGGGGTGGAGG - Intergenic
1122158455 14:99765383-99765405 TAGCCAGGGGCCTGGCGTGGTGG - Intronic
1122236026 14:100330998-100331020 CTGCCAGAGGGCTGCTGTGGTGG - Intergenic
1122267008 14:100551238-100551260 CTGCTAGGGTGTTGGCCTGCTGG + Intronic
1122366194 14:101196162-101196184 CTGCCAGGGGGTGGGCAGTGGGG - Intergenic
1122861528 14:104584706-104584728 CATCCAGGGGGGTGGCGGGGAGG - Intronic
1124011994 15:25846137-25846159 TTGCCAGGGGCTGGGCATGGGGG + Intronic
1124215628 15:27805562-27805584 CTGCCCGGGTGTTGGCGGGAGGG + Intronic
1124431825 15:29614767-29614789 CTGCAAGGGGCTGGGCATGGTGG + Intergenic
1124964023 15:34419939-34419961 CTGCCAGGGGCTGGGGGAGGCGG + Intronic
1124980637 15:34566170-34566192 CTGCCAGGGGCTGGGGGAGGCGG + Intronic
1126537081 15:49778211-49778233 TTCCCAGGGGTTTGGGGTGGGGG - Intergenic
1127450447 15:59111319-59111341 CCACCAAGGGCTTGGCGTGGTGG - Intronic
1127606444 15:60592260-60592282 CTGCCCGGGGCTCGGCGCGGGGG - Intronic
1128157990 15:65403861-65403883 CTCCATGGGGGTTGGGGTGGTGG + Intronic
1128184164 15:65630278-65630300 CTGCCAGGGACCAGGCGTGGTGG - Intronic
1128386999 15:67156799-67156821 CTGCCTGGGGGTGGGCGGGTGGG + Intronic
1128497461 15:68206593-68206615 CTGCCATGGGGTTTGGGAGGGGG - Intronic
1128698629 15:69788011-69788033 CTGCCAGGAGGTTGTTGGGGAGG + Intergenic
1128741771 15:70088885-70088907 CTGCCGCGGGGTGGGGGTGGGGG - Intronic
1129170461 15:73804429-73804451 ATGCTTGGGGGTTGGCGAGGGGG + Intergenic
1129228264 15:74182263-74182285 CTGCCAGTGGGGTGGGGAGGTGG + Intronic
1130028880 15:80294312-80294334 CTGTCAGGGGCCGGGCGTGGTGG - Intergenic
1130168592 15:81487886-81487908 CTGTCAGGGGGTTGGGGGGAGGG - Intergenic
1130358066 15:83153303-83153325 CTGCCAGGGGCCAGGCATGGTGG - Intronic
1130960874 15:88657916-88657938 CTGCCTGGGAGTGGGGGTGGTGG - Intergenic
1131149344 15:90037104-90037126 CTGGCAGGGGCTCGGGGTGGGGG + Intronic
1131528116 15:93168271-93168293 CTGCCAGGGGCTGGGTGTAGCGG - Intergenic
1132617885 16:851412-851434 GAGCCAGGGGGTTGCCGTGTGGG + Intergenic
1133124743 16:3639396-3639418 AAGCCGGGGGGTTGGTGTGGGGG - Intronic
1133131741 16:3680409-3680431 CAGCCAGGGAGAAGGCGTGGGGG - Intronic
1134164549 16:11919709-11919731 TTACCAGGGGGTTGGGGAGGGGG - Intergenic
1134223814 16:12376226-12376248 GTGCCAGGGACGTGGCGTGGGGG - Intronic
1135461834 16:22651261-22651283 CTGCCAGGGGGTGGGGGGAGCGG - Intergenic
1136226550 16:28864024-28864046 CTGGGTGGGGGTGGGCGTGGAGG + Intronic
1136247114 16:28982431-28982453 CAGCCCGGGGGTTGGAGTGGCGG - Exonic
1137370682 16:47903101-47903123 CTGCTAGGGGGTGGGTGTTGGGG + Intergenic
1137639475 16:50015848-50015870 CTTCCAGGGGCTGGGGGTGGAGG - Intergenic
1137666797 16:50254806-50254828 TTGGCAGGGGGTGGGGGTGGGGG - Intronic
1138025993 16:53522935-53522957 TTGCCAGGGGCTGGGCGCGGTGG - Intergenic
1138595327 16:58026464-58026486 CTGCCTGGGCCTTGGCGTAGCGG + Exonic
1138649558 16:58451555-58451577 CTGGCAGGGGGTTGGGGGGGGGG + Intergenic
1139671001 16:68492527-68492549 CAGCCACAGGGTTGGGGTGGGGG + Intergenic
1140123996 16:72105420-72105442 CTGGCAGGGGGTGGGCTAGGAGG + Intronic
1140649049 16:77066592-77066614 CTGTCAGAGGGTAGGGGTGGGGG + Intergenic
1141005283 16:80346313-80346335 GTGTCAGGGGGCTGGGGTGGGGG + Intergenic
1141138069 16:81479506-81479528 CTGCCAGGGGCTGGGGGAGGGGG - Intronic
1141188940 16:81809490-81809512 CTGCAAGGGGAATGGGGTGGTGG - Intronic
1141607185 16:85160747-85160769 CGCCCAGGGGGTTGGGCTGGTGG + Intergenic
1141738426 16:85871957-85871979 CTGCCAGGCAGTAGGCGTGGAGG - Intergenic
1142356799 16:89605176-89605198 CTGCAAGGGGGTTCGGGTGGTGG + Intergenic
1143558355 17:7676459-7676481 CTGCTAGGGGGCTGGGGTTGGGG + Intronic
1144075971 17:11719507-11719529 CTTCCTGGGGGTGGGGGTGGGGG + Intronic
1144451557 17:15384259-15384281 GTTCCAGGGGGTTGGCAGGGAGG - Intergenic
1144941741 17:18946917-18946939 CTGCCAGAGGCTTGGGGAGGGGG + Intergenic
1145117418 17:20224623-20224645 CTGCCACAGGCTTGGGGTGGCGG - Intronic
1145275309 17:21425597-21425619 CTGCCAGGGGCTGAGGGTGGAGG + Intergenic
1145283238 17:21483715-21483737 TTGCCAGGGGCTGGGAGTGGAGG + Intergenic
1145313165 17:21711491-21711513 CTGCCAGGGGCTGAGGGTGGAGG + Intergenic
1145394245 17:22482085-22482107 TTGCCAGGGGCTGGGAGTGGAGG - Intergenic
1146786992 17:35729585-35729607 CTCCCAGAGGGTTGGGGTGGGGG - Intronic
1146885785 17:36469915-36469937 CAGACACGGGGTTGGCGGGGGGG - Intergenic
1146956715 17:36940267-36940289 CTGCGGGGGGGTGGGGGTGGGGG - Intronic
1147139390 17:38452841-38452863 ATGCCAGGGGGTGGGAGAGGGGG + Intronic
1147241368 17:39092806-39092828 CTGCCTGGGGGCTGGGGTGCAGG + Intronic
1147976184 17:44249520-44249542 CTGCCCTGGGGTGGGGGTGGGGG - Exonic
1148073174 17:44920585-44920607 CTGCGATGGGGTTGGCGGAGGGG + Intergenic
1148513779 17:48196969-48196991 CTGCTTGGGGCTGGGCGTGGTGG + Intronic
1148630148 17:49101045-49101067 CTGCTAGGGGGCTGGCATGGTGG - Intergenic
1148691617 17:49530506-49530528 TCGCCAGGGGGTTGGCGGAGGGG - Intergenic
1148765847 17:50037784-50037806 CTGCCAGGCGGGTGGGCTGGGGG + Intergenic
1148785067 17:50142239-50142261 CTCCCAGGGAGGTGGAGTGGAGG - Intronic
1149494526 17:57108897-57108919 CTGACAGGGGCTGGGCGAGGGGG - Intronic
1149644155 17:58227684-58227706 CTGCAAGGGGTTGAGCGTGGTGG - Intronic
1150197697 17:63318021-63318043 CTGCAGGGGGGTGGGCATGGAGG - Intronic
1151421163 17:73998904-73998926 CTGCTAGGGGCTTGAGGTGGAGG - Intergenic
1152225728 17:79091752-79091774 TTGCAAGGGGGTTGTCCTGGAGG - Intronic
1152243800 17:79175001-79175023 ATGCCTGGGGGTTGGCACGGGGG - Intronic
1152250309 17:79209104-79209126 CAGCCAGGGGCCGGGCGTGGTGG - Intronic
1152306368 17:79523114-79523136 TTGCCAGGGGCTTGTGGTGGGGG + Intergenic
1152385619 17:79972638-79972660 CTGCCAGGGGCTTGGGGGAGAGG + Intronic
1152655136 17:81515724-81515746 CGGCCAGGTGGTTGGCGGTGGGG - Intronic
1152664503 17:81559467-81559489 CTGCCAGAGTGTGGGCATGGGGG + Intronic
1153012017 18:547852-547874 CTGCCAGAGGCTGGGCGTGGTGG + Intergenic
1153254115 18:3153006-3153028 CTGCTAGGGGTTTGGGGAGGTGG + Intronic
1153701807 18:7701849-7701871 CTGTCAGGGGGTTGGGGAGTAGG - Intronic
1156709091 18:39920110-39920132 CTGTCATGGGGTTGGGGTGAGGG - Intergenic
1157177466 18:45464774-45464796 CTCCAAGGGGGCTGGTGTGGAGG + Intronic
1157376938 18:47175962-47175984 GGCCCAGGGGGTTGGGGTGGAGG - Intronic
1157481161 18:48054657-48054679 ATGCCAGGCGGTTCTCGTGGTGG - Intronic
1157572196 18:48720630-48720652 CTGCTTGGGGGTGGGCGTGAGGG - Intronic
1157588174 18:48818502-48818524 CTGCCCGGAGGTTGGCCGGGTGG + Intronic
1157592079 18:48842070-48842092 CTGCCAGGGGGTGGGAGGGTTGG + Intronic
1160463659 18:79058009-79058031 GGGCCAGGGGGTGGGGGTGGGGG - Intergenic
1160792997 19:931523-931545 CTGCCAATGGCTGGGCGTGGTGG + Intronic
1160943854 19:1632213-1632235 CTTCCAGGGGTTTGGACTGGGGG - Intronic
1161048900 19:2151635-2151657 CTGCCGGGGAGGTGGCGGGGCGG - Intronic
1161366306 19:3881688-3881710 CTGGCAGGGGGTGGGGGTCGGGG + Intronic
1161636727 19:5393857-5393879 CTGCCAAGGGGATGGTTTGGGGG - Intergenic
1162022649 19:7874675-7874697 GTGCCAGGTGGTTGTGGTGGGGG - Intergenic
1162533191 19:11247603-11247625 CTCCCCGGGGGCTGGTGTGGAGG + Intronic
1162819224 19:13212595-13212617 CTGCCAGGGAGGTGGAGTGTGGG - Intronic
1163068656 19:14819317-14819339 CTGTCAGGGGGTGGGGGTGAGGG - Intronic
1163293550 19:16396932-16396954 CTGCCAGGGGCTGTGGGTGGGGG + Intronic
1163470098 19:17491320-17491342 TTGCCAGGGGCTGGGGGTGGAGG - Intronic
1163682135 19:18688901-18688923 CTGCCAGGGGCTGGGCAAGGGGG - Intronic
1163719407 19:18891580-18891602 CTGCCTGGGGGTTGGGGGTGTGG - Intronic
1163730772 19:18948046-18948068 CTGCCAGGGGGTGGGAGTGGGGG + Intergenic
1163762779 19:19146317-19146339 CTGCCAGGGGGCCAGGGTGGGGG + Exonic
1164733450 19:30523131-30523153 CTGGCTTGGGGTTGGCGCGGGGG + Intronic
1165068025 19:33240335-33240357 GTGCCAGGGAGCTGGCCTGGAGG - Intergenic
1166008544 19:39924652-39924674 CTGCCAGGTGGTAGGCGGGAAGG - Exonic
1166119886 19:40679798-40679820 TTGCCAGGGGGCTGGGGTAGTGG + Intronic
1166530455 19:43539986-43540008 CTGTCAGGGGGTGGGGGTGGGGG + Intergenic
1166773346 19:45297809-45297831 CGGGCAGGGGGTGGGGGTGGTGG + Exonic
1166790656 19:45396686-45396708 CCGCCAGGGGGCTGCCGCGGGGG + Exonic
1166985660 19:46659039-46659061 CTGGCAGGGGCTGGGGGTGGGGG + Intronic
1168184544 19:54690872-54690894 CTGTCAGGGGGTTGGGTAGGGGG + Intronic
1168651911 19:58097387-58097409 GACCCAGGGGGTTGGGGTGGGGG - Intronic
926229741 2:10993259-10993281 CTGCCAGGGAGCAGGCGGGGAGG + Intergenic
926242124 2:11096562-11096584 CAGCCTGGGGGTGGGGGTGGGGG + Intergenic
926297393 2:11578695-11578717 CTGTGCGGGGGTTGGGGTGGGGG - Intronic
927095777 2:19746850-19746872 CTGGCTGGGGGTTGGGGCGGGGG - Intergenic
928361921 2:30670517-30670539 CTGCCAGGCTGTTAGTGTGGGGG + Intergenic
928493485 2:31807492-31807514 CTGCCAGGGGGTGGGTGGAGGGG + Intergenic
929165760 2:38879614-38879636 TTGCCAGGGGTTTGGGGTTGTGG + Intronic
929234081 2:39588367-39588389 CTGCCATAGGGTTGGAGTCGGGG + Intergenic
930666229 2:54101381-54101403 CTGCCAGGGGCCGGGCGCGGTGG + Intronic
930981596 2:57532333-57532355 CTGTCAGAGGGGTGGTGTGGAGG + Intergenic
931298221 2:60950970-60950992 CTATCAGTGGGTTGGAGTGGAGG - Intronic
931517846 2:63059989-63060011 CGGCCCGGGGGTGGGGGTGGGGG - Intergenic
931582883 2:63796495-63796517 CTGCCAGGGGATGGGGGAGGGGG - Intronic
934564386 2:95330280-95330302 CTGCCAAGGGCTGGGGGTGGAGG + Intronic
934651860 2:96097048-96097070 CTGCCAGGGGCTTGGGGGAGGGG + Intergenic
934960040 2:98665040-98665062 ATGCCAGGGGCTGGGTGTGGTGG + Intronic
935272466 2:101446797-101446819 GTGCCAGGGGGTGGGGGTGGGGG + Intronic
936274540 2:111083028-111083050 CTGTCAGGGGGTTGGGGTTAGGG + Intronic
936584396 2:113741263-113741285 TTGCCAGGGGCTGGGGGTGGTGG + Intronic
937205661 2:120235511-120235533 CTGCCAGGGGGTTGGGGGTTAGG + Intergenic
937210334 2:120264762-120264784 CTGCCAGGGGGTGGGGGAAGAGG - Intronic
937908138 2:127062279-127062301 CTGGCAGGGGCTGGGGGTGGTGG - Intronic
938077832 2:128349742-128349764 TTGCCAGGGGCTGGGCGTGGTGG + Intergenic
938451554 2:131425358-131425380 CTGCCAGGGGCACGGCGTAGGGG - Intergenic
940185974 2:150985421-150985443 CTGGCAGAGGGATGGAGTGGTGG - Intergenic
940195978 2:151094535-151094557 CTGCCAGAGGGTTGGGGAGGTGG + Intergenic
941065691 2:160900260-160900282 CTGTCAGGGGGTGGGGGTAGGGG - Intergenic
941917112 2:170820162-170820184 CCGCCTGGGGGTGGGGGTGGGGG + Intronic
942231494 2:173864611-173864633 TTGCCAGGGGGTTGAAGTGCTGG - Intergenic
942474617 2:176306061-176306083 CTGTCAGGGGGTGGGGGTGCTGG - Intronic
943715476 2:191147490-191147512 TTGCCAGGGGTTGGGGGTGGAGG + Intronic
944173402 2:196803066-196803088 CTCCCGGGGGCCTGGCGTGGTGG - Intergenic
944479018 2:200135974-200135996 CTCCCAGGAGGTTGGGGTGTGGG + Intergenic
944685130 2:202111207-202111229 ATGCCAGTGGCTGGGCGTGGTGG + Intronic
945322530 2:208441645-208441667 TTGCCAGGTGTTTGGCATGGTGG + Intronic
945579856 2:211579792-211579814 CTGTCAGGGGGTGGGGTTGGGGG + Intronic
945699210 2:213150319-213150341 CTGCAGGGGGCTTGGCTTGGAGG - Intronic
946399491 2:219461015-219461037 CTGCTGGGGGCTTGGGGTGGGGG + Intronic
946513149 2:220382363-220382385 CTGCCATGGGGTTGGGGGAGTGG - Intergenic
946530277 2:220563289-220563311 TTGCCAGGGGCTTGGGGTGCAGG + Intergenic
947555582 2:231090253-231090275 CTGCCATAGGCTGGGCGTGGTGG + Intronic
947714021 2:232330916-232330938 CTGCCAGAGGGTGGGAGAGGAGG + Intronic
947733229 2:232442296-232442318 CTGCCAGAGGGTGGGAGAGGAGG + Intergenic
947741281 2:232486133-232486155 CGGCCCGGGGGTGGGCCTGGCGG - Exonic
948949393 2:241239124-241239146 CTGGCAGGGGAGTGGCCTGGAGG + Intronic
949023232 2:241752927-241752949 CCGCCCTGGGGGTGGCGTGGGGG - Intronic
949041474 2:241851807-241851829 CTGCCTGGGGGCTGGGGAGGTGG + Intronic
1168923020 20:1556963-1556985 CTGCCAGGGGCCAGGTGTGGTGG + Intronic
1168966919 20:1904362-1904384 TTGGCTGGGGGTTGGCTTGGAGG + Intronic
1169024352 20:2355952-2355974 TTGTCAGGGGCTTGGGGTGGGGG + Intergenic
1169375639 20:5064881-5064903 ATACCAGGGGCTAGGCGTGGTGG + Intergenic
1169867675 20:10218423-10218445 CTGAAAGGGGGTGGGGGTGGGGG + Intergenic
1170013871 20:11758568-11758590 CTGCCAGGGGCTGGAGGTGGAGG - Intergenic
1170555205 20:17509243-17509265 CAGACAGGGGGTGGGGGTGGGGG - Intronic
1170999085 20:21396082-21396104 CTGGCCGGGGGTGGGCGTGCTGG + Exonic
1171086467 20:22242584-22242606 CTGGCAGTGGGGTGGGGTGGAGG + Intergenic
1171102700 20:22400427-22400449 TTGCCAGGGGCTTGGGGTGGGGG - Intergenic
1172427322 20:34863841-34863863 CTTCCTGGGGGGTGGGGTGGGGG + Intronic
1172610755 20:36250609-36250631 ATGCCAGGGGGTAGGGGTGAAGG + Intronic
1172736363 20:37128876-37128898 CTGCCAAGGGATTGACATGGAGG - Intronic
1175013819 20:55766645-55766667 TTGCCAGGGAGTGGGGGTGGTGG + Intergenic
1175249145 20:57598303-57598325 GTGCCCCGGGGTGGGCGTGGGGG + Intergenic
1175339467 20:58218932-58218954 CTGCCAGGGGAGTGGACTGGGGG - Intronic
1176245454 20:64094734-64094756 CACCCAGGGGGATAGCGTGGGGG + Intronic
1176372370 21:6069779-6069801 GTGCCAGGGGGTTGGGCGGGTGG + Intergenic
1178513397 21:33226434-33226456 CTTCCTGGAGGTTGGGGTGGAGG + Intergenic
1179399159 21:41068591-41068613 CTGGCAGGGGGCTGGCTAGGCGG - Intergenic
1179606568 21:42519611-42519633 CTGCCAGGGGGTTGGCGTGGAGG - Intronic
1179751148 21:43468760-43468782 GTGCCAGGGGGTTGGGCGGGTGG - Intergenic
1179804216 21:43826799-43826821 GTGCCAGGGGAGGGGCGTGGTGG - Intergenic
1179937827 21:44616332-44616354 CTGCCAGGATGTTGCCTTGGGGG + Intronic
1180005428 21:45018574-45018596 CTGCGAGGGGCTTCGCGTGGCGG + Intergenic
1181486840 22:23236909-23236931 CTGGCAGGGGGTAGCTGTGGAGG + Intronic
1181696212 22:24594039-24594061 CTGACAAGGGGTGGGGGTGGCGG + Intronic
1182042740 22:27251019-27251041 CTGGCAGGGGGATGGGGTGGAGG - Intergenic
1182299610 22:29330305-29330327 ATGCCAGGGGGTGGCCCTGGTGG - Intronic
1182715718 22:32354784-32354806 CTGCCTGTGGCGTGGCGTGGTGG - Intergenic
1183520394 22:38293440-38293462 CTGCCTGGAGGTGGGGGTGGGGG - Intronic
1183582007 22:38731767-38731789 CAGCCACAGGGGTGGCGTGGTGG - Exonic
1183985441 22:41567594-41567616 CTGCCAGGGCGTGGGCTTGGAGG - Intronic
1184053153 22:42023780-42023802 CTGGCAGGGGCTGGGTGTGGTGG - Intronic
1184729513 22:46365031-46365053 CGCTCAGGGGGTTGGCCTGGAGG + Intronic
1184729953 22:46366566-46366588 CAGCCAGGGTGTGGGTGTGGGGG - Intronic
1184860693 22:47171733-47171755 CTGTCAGGCGGTGGTCGTGGGGG + Intronic
1184871592 22:47243941-47243963 CTCCCAGGGGCTGGGCCTGGGGG - Intergenic
1185277957 22:49957869-49957891 GAGCCAGGAGGTGGGCGTGGCGG - Intergenic
1185323748 22:50215623-50215645 GTGCCAGGGGGGTGGGGGGGGGG + Intronic
949895935 3:8767719-8767741 CTGCCAGGCGGTCGGTGCGGCGG + Exonic
950017547 3:9764945-9764967 CTGCCAGGAGTTGGGTGTGGTGG + Intronic
950490555 3:13302141-13302163 GTGTCAGGGAGTTGGGGTGGGGG - Intergenic
950522799 3:13506596-13506618 TTGGCAGGGGGGTGGGGTGGGGG + Intergenic
950719048 3:14869600-14869622 CTGCCAGGGGATAGGGGAGGAGG - Intronic
951528266 3:23674475-23674497 CTACCTGGGGCTGGGCGTGGTGG + Intergenic
952078563 3:29729138-29729160 CTGTCAGGGGGTTGGGGGGTGGG - Intronic
953032944 3:39189865-39189887 CTGCCAGGGGAGTGGCCTGGGGG + Intronic
953337942 3:42109946-42109968 CTGTCATGGGGTAGGGGTGGCGG + Intronic
953384949 3:42501246-42501268 CTGCCATGGGGTGGGCTTGAGGG - Intronic
953678268 3:45020248-45020270 TTTCCAGGGGCTTGGGGTGGGGG - Intronic
953735848 3:45493384-45493406 CATCCAGGGGCTGGGCGTGGTGG - Intronic
954100201 3:48366536-48366558 TTGCCAGGGGTTAGGGGTGGTGG + Intergenic
954424369 3:50435632-50435654 CTGACAGGGGGATGGGGTGGGGG + Intronic
954624701 3:52016164-52016186 CTGCCCAGGGGATGGGGTGGCGG - Intergenic
954799595 3:53179495-53179517 CTGCCAGGGGAAGGCCGTGGAGG + Intronic
955236259 3:57142537-57142559 CTGCCAGGAGGCCGGAGTGGGGG - Intronic
955297103 3:57746041-57746063 CAGAAAGGGGGTTGGGGTGGGGG - Intergenic
955670775 3:61399709-61399731 TTGCCAGGGGCTAGGAGTGGGGG + Intergenic
956397533 3:68841693-68841715 CTGTCAGGGGGTTGGGGGGTAGG - Intronic
956454742 3:69409493-69409515 CTGCCAAGGGGTTGGCCAGATGG + Intronic
956791491 3:72683501-72683523 CTGGCAGGGGGTGGGGGTGGGGG + Intergenic
959693461 3:109224279-109224301 CTGCAAGGGGCTGAGCGTGGTGG - Intergenic
959828448 3:110831011-110831033 CTGTCAGGGGGTTGGGGTGAGGG - Intergenic
959978437 3:112487891-112487913 TTGCCTGGGGGTTGGCTTGGAGG - Intronic
961116162 3:124332092-124332114 CTGCCAGGGGAGTGGGGTGGGGG - Intronic
961211887 3:125131893-125131915 CTGCCAGGGAGTTGGCGGGGTGG - Intronic
965469957 3:169078639-169078661 TTGCCAGGGGCTTGGGGAGGTGG - Intergenic
965528602 3:169747829-169747851 CTGCCAGGGAATAGGGGTGGTGG - Intergenic
965623237 3:170661310-170661332 CTGCCAGGGGCTCGGAGTAGAGG - Intronic
966382244 3:179355662-179355684 CAGCCAGGGGCCAGGCGTGGTGG + Intronic
967186699 3:186950197-186950219 CTGCCAGGCAGTTGGGGCGGGGG + Intronic
967819890 3:193830912-193830934 CTGCCAGGTGGCAGGCGTGATGG + Intergenic
968582472 4:1401483-1401505 CTGCCTGGGGCTTGGGGTGTGGG + Intergenic
968807942 4:2787359-2787381 CTGGCAGGGGGTGGTGGTGGGGG + Intergenic
968888971 4:3356536-3356558 CTGCCAGGGGTTGGGGGTGGGGG - Intronic
968896957 4:3409878-3409900 CTGCCTGGAGGGTGGCCTGGAGG - Intronic
969439408 4:7208386-7208408 CAGGCAGGGGATTGGCGGGGAGG + Intronic
969519920 4:7670740-7670762 CTGCCATGGGGCCGGGGTGGGGG - Intronic
969834606 4:9830353-9830375 CTATCAGGGGGTTGTGGTGGAGG + Intronic
972068849 4:34988767-34988789 CTGCTATGGGCTGGGCGTGGTGG + Intergenic
974390581 4:61261554-61261576 CTGCCAGGGTGTGTGTGTGGTGG + Intronic
974626382 4:64432382-64432404 CTTCCAGGGGGCTGATGTGGAGG + Intergenic
974758360 4:66242831-66242853 CTGTCATGGGGTGGGCGGGGAGG - Intergenic
975701902 4:77075374-77075396 CTGCCACGGGGGCGGCGCGGGGG + Intronic
976002689 4:80390281-80390303 TTGCCAGGGGGTTGGGGGGTAGG - Intronic
977004553 4:91548760-91548782 AAGCCAGGGGGATGGTGTGGGGG - Intronic
977882995 4:102227341-102227363 CTGTCAGGGGGTTGGGGGGAAGG + Intergenic
978308433 4:107357636-107357658 TTGCCAGGGGCTAGGAGTGGGGG + Intergenic
978325333 4:107547491-107547513 CTGTCGGGGGGTGGGGGTGGGGG - Intergenic
978541310 4:109818850-109818872 TTTCCAGGGGCTGGGCGTGGTGG - Intronic
979114979 4:116812091-116812113 GTGGCAGGGGGTTGGGGTAGGGG + Intergenic
984336105 4:178393529-178393551 CTGCCAGGGGGTTGGGGGCTAGG - Intergenic
984360438 4:178723746-178723768 CTGTCAGGGGGTAGGGGTTGGGG - Intergenic
984439233 4:179745782-179745804 CTGTCAGGGGGTTGGGGGGAAGG + Intergenic
985671316 5:1208391-1208413 CTGCCAGGGGGTGGGTGGGGAGG + Intronic
985927847 5:3031730-3031752 CTGCCAGGGGTTCAGCGGGGAGG + Intergenic
986308508 5:6533194-6533216 GTGCCATGGGCTGGGCGTGGTGG + Intergenic
987532491 5:19140667-19140689 CTGTCAGGGGTGTGGCCTGGTGG - Intergenic
987606314 5:20140312-20140334 CTGTCATGGGGTTGGGGAGGGGG + Intronic
987936861 5:24478297-24478319 GGGAGAGGGGGTTGGCGTGGAGG + Intergenic
988235260 5:28535845-28535867 CTGTCGTGGGGTTGGGGTGGGGG - Intergenic
988727112 5:33936921-33936943 CTGCCCGGGGGATGTCCTGGCGG - Exonic
988966688 5:36425728-36425750 CTCCCAAGAGGTTGGCGTGTTGG + Intergenic
991217965 5:64177916-64177938 CTGCCTGGGGCTGGGCGTGGTGG + Intronic
992274072 5:75096809-75096831 CTGTCATGGGGTGGGGGTGGGGG - Intronic
992295555 5:75323284-75323306 CTGCCTGGAGGTTGGAGTGCTGG + Intergenic
992722063 5:79570524-79570546 CTCCCAAGGGCTGGGCGTGGTGG - Intergenic
994274833 5:97822878-97822900 CTGCCAGGGGGATGGGGAAGGGG + Intergenic
995514295 5:112938867-112938889 CTGACAGGGGCCGGGCGTGGTGG - Intergenic
996084228 5:119287604-119287626 CTGCCAGGGGCTGGGTTTGGAGG - Intronic
997074698 5:130659065-130659087 CTGGCAGTGGGTTGGGGAGGAGG + Intergenic
997372245 5:133369519-133369541 CTGGCAGGGGGTTGGGTGGGAGG + Intronic
997722279 5:136088729-136088751 CTGCCAGTGGCTGGGTGTGGAGG + Intergenic
997899491 5:137752763-137752785 CTGGGTGGGGGTTGGGGTGGGGG - Exonic
997984437 5:138491846-138491868 CTGCCGGGGGGCCCGCGTGGCGG - Intergenic
998409238 5:141896594-141896616 CTGCCAGGGCCTTGGCGGGCAGG + Intergenic
1000253777 5:159519212-159519234 TTGCCAGGGGGTAAGGGTGGGGG - Intergenic
1001692128 5:173641145-173641167 TTGCCAGGTGGTGGGCGTGGGGG + Intergenic
1001883285 5:175264560-175264582 CTGCCATGGGGTTGGGGGTGTGG - Intergenic
1001945071 5:175771965-175771987 GTGCCAGGAGGGTGGCATGGTGG - Intergenic
1002024158 5:176385429-176385451 CCCCCAGGTGGTTGGTGTGGTGG - Intronic
1002095415 5:176828082-176828104 CTGGCTGGGGGTGGGTGTGGAGG - Intronic
1002186484 5:177457077-177457099 CTGCTTGGGGCCTGGCGTGGGGG - Exonic
1003376714 6:5585475-5585497 TTGCCAGGGGATGGGGGTGGGGG - Intronic
1004426543 6:15510736-15510758 CTGCCAAGGAGTTGGCCTTGAGG + Intronic
1004439947 6:15640872-15640894 CTGTCCAGGGGTTGGGGTGGTGG - Intronic
1004714986 6:18208247-18208269 CTGCCAGGGGCTTGGAGGGAAGG + Intronic
1006130089 6:31863845-31863867 CTGCCCGGGGGTAAGGGTGGTGG - Intronic
1006190383 6:32204004-32204026 CTGGGCGGGGGTGGGCGTGGAGG + Intronic
1006424650 6:33956454-33956476 CCGCCAGGGGGCTGGGGTGGTGG + Intergenic
1006484739 6:34329796-34329818 CTGCCATGGGGTGGGGTTGGGGG - Intronic
1007687124 6:43673571-43673593 CTGGCAGGGGGTGGGCCGGGTGG + Intronic
1007796770 6:44355168-44355190 TTGCCAGGGGGTGGGAGGGGTGG - Intronic
1008967100 6:57323619-57323641 CTGTCAGGGGGTTGGGGTCAAGG + Intronic
1009268578 6:61589061-61589083 CTGTCAGGGGGTGGGGGTAGGGG + Intergenic
1010774711 6:79871468-79871490 CTGTCAGGGGGTTGGGGGGTAGG + Intergenic
1011310914 6:85978509-85978531 CCCCCAGGGAGTTGGGGTGGGGG - Intergenic
1012411036 6:98957294-98957316 CTGTCAGGGGGTGGGGGTGTTGG + Intergenic
1013459248 6:110358951-110358973 CTGACAGCGGGTTGGTGAGGAGG + Intergenic
1014649451 6:124017775-124017797 CAGCCGGGGGGTCGGGGTGGGGG - Intronic
1015779048 6:136844655-136844677 TTGCCAGGGGCTGGGGGTGGGGG - Intronic
1015874433 6:137808807-137808829 CTGCCGTGGGGCTGTCGTGGGGG - Intergenic
1016197723 6:141366446-141366468 CTGTCAGGGGGATGGGATGGGGG - Intergenic
1016988602 6:149913313-149913335 CTGCCTGGGGATTTGCATGGAGG + Intergenic
1018798095 6:167202776-167202798 CTGGAAGGGGGCTGGCCTGGCGG + Intergenic
1018814617 6:167321400-167321422 CTGGAAGGGGGCTGGCCTGGCGG - Intergenic
1019005713 6:168794844-168794866 CTGCCAGGGCCTGGGCGTGGTGG - Intergenic
1019564068 7:1670925-1670947 CTGGCGGGGGGGTGGGGTGGGGG + Intergenic
1019615270 7:1956589-1956611 CTGCCAGGGCCTTGGAGGGGTGG - Intronic
1019623192 7:2002591-2002613 CTGCTTGGGGGTGGCCGTGGTGG - Intronic
1019687645 7:2390605-2390627 CTGCCAGGATGTGGGCGTGTAGG - Intergenic
1020113943 7:5464774-5464796 CTACCAGTGGCTGGGCGTGGTGG + Intronic
1021175009 7:17440231-17440253 CGGGCAGGGGGTGGGGGTGGGGG - Intergenic
1021886042 7:25140664-25140686 CAGCCAGGGGGATGGGGCGGAGG - Intronic
1022060762 7:26792171-26792193 TTGCCAGGGGCTGGGTGTGGAGG + Intronic
1022138575 7:27472531-27472553 CTCCCTGGGGGATGGCGGGGGGG - Intergenic
1022403367 7:30063104-30063126 ATAACAGCGGGTTGGCGTGGGGG + Intronic
1022605868 7:31813346-31813368 CTGCCAGGGTGCTGGGGTGGGGG + Intronic
1022612870 7:31894819-31894841 CTCCCTGGGGGTTCTCGTGGTGG - Intronic
1023410361 7:39883767-39883789 TTGCCAGGGGGTTGGAGGAGGGG + Intergenic
1023868973 7:44252529-44252551 CGGGCAGGGGGTGGGGGTGGGGG + Intronic
1023990177 7:45124092-45124114 CGGCCAGGGGGGTGGTGGGGAGG + Intergenic
1024024218 7:45397649-45397671 CTGCCAGAGGCTTGGCTTTGGGG + Intergenic
1024129382 7:46335148-46335170 CTGTCAGGGGGTGGGGGTTGGGG - Intergenic
1024230421 7:47359372-47359394 GTGCCAGGGGTTTGGCAGGGAGG + Intronic
1024578851 7:50785533-50785555 CTGGGAAGGGGTTGGGGTGGAGG - Intronic
1026117218 7:67506081-67506103 CTGCCTGGGGGCAGGTGTGGTGG + Intergenic
1026673149 7:72406901-72406923 CTGACAAGGGGCTGGCGCGGTGG - Intronic
1027266869 7:76499371-76499393 TTGGCAGGGAGGTGGCGTGGTGG - Intronic
1027318685 7:76999231-76999253 TTGGCAGGGAGGTGGCGTGGTGG - Intergenic
1028770251 7:94611473-94611495 CTGCCTAGGGGTAGGGGTGGGGG + Intronic
1029130798 7:98329378-98329400 CTGCTGGGGGCTTGGCATGGAGG + Intronic
1029585814 7:101470379-101470401 CTACCCGGGGCTGGGCGTGGTGG - Intronic
1031376440 7:121032532-121032554 CTGTCAGGGTGTCGGGGTGGTGG + Intronic
1033143617 7:138851552-138851574 ATGCCTGGGGGTGGGTGTGGGGG + Intronic
1033243112 7:139697100-139697122 CTGGCAGGGGGTCGGGGAGGAGG - Intronic
1033403573 7:141050555-141050577 CTGACAGGGGGGTGTAGTGGGGG + Intergenic
1033888520 7:145978472-145978494 CTGCCAGGGGGTGGGTGGCGAGG + Intergenic
1034604246 7:152296139-152296161 ATGCCAGGGGCAGGGCGTGGTGG + Intronic
1034683629 7:152950632-152950654 CTCCAAGGGGGTGGGCGTGGTGG + Intergenic
1034859767 7:154585081-154585103 CTGCCAGGGACTAGGGGTGGAGG - Intronic
1036766148 8:11550408-11550430 CTGCCCGGGAGTTGACATGGGGG + Intronic
1036985656 8:13526766-13526788 CTGCCAGGGGGTTGGGGGACAGG + Intergenic
1037127084 8:15364865-15364887 CTGCCAGGGGCTGGGAGTAGGGG + Intergenic
1037751578 8:21685819-21685841 CTGGCAGGGGCTGGGCGTGGTGG - Intergenic
1037891661 8:22626957-22626979 CTCCTCGGGGGATGGCGTGGTGG + Intronic
1039170938 8:34744030-34744052 CTGCCAGGGGGTTGGGGGAGCGG + Intergenic
1039378270 8:37059459-37059481 CTGCCAGGGGATTGATGGGGAGG + Intergenic
1039762995 8:40598359-40598381 CTGTCAGGGGGTGGGGGTGAGGG - Intronic
1040413976 8:47181278-47181300 CTGCAAGGGGGTGGGGATGGGGG - Intergenic
1041277862 8:56181567-56181589 TTGGCAGGGGGTGGGGGTGGGGG + Intronic
1042366701 8:67945449-67945471 TTGCCAGGGGCTTGCAGTGGGGG + Intergenic
1042719402 8:71810899-71810921 TTGCCAGGGGGGTGGGGCGGGGG + Intergenic
1042719821 8:71815108-71815130 ATGCCAAGGGCTGGGCGTGGTGG - Intergenic
1043624132 8:82233330-82233352 ATGCCTGTGGGTTGGCATGGTGG - Intergenic
1043909009 8:85839050-85839072 CTGCAAGGGGGTTGGGGGGGGGG - Intergenic
1044561532 8:93617375-93617397 CTGGCAGGAGGTGGGCCTGGTGG + Intergenic
1044596482 8:93963977-93963999 CTGTCAGGGGGTGGGGGTGCTGG - Intergenic
1044730546 8:95225564-95225586 CTTCCTGGGGCTTGGCCTGGGGG + Intergenic
1045220974 8:100200093-100200115 CTGTCATGGGGTTGGAGTGAGGG - Intronic
1045224833 8:100234425-100234447 CTGCCTGAGGGTAGGGGTGGAGG - Intronic
1045547783 8:103143287-103143309 CTGGCAGGGGGTGGGTGAGGTGG - Intronic
1046064331 8:109178576-109178598 TTGCCAGGGGGTAGAAGTGGGGG + Intergenic
1049472878 8:142784080-142784102 CTGCGAGGGAGCTGGCCTGGGGG + Intergenic
1050091212 9:2017229-2017251 CTGCTTGGGGGGTGGGGTGGAGG + Intronic
1051265601 9:15306517-15306539 CTGCCAGGGGCTGGGGCTGGAGG - Intronic
1052451000 9:28631305-28631327 CTGTCATGGGGTGGGGGTGGGGG - Intronic
1052656789 9:31373666-31373688 CTGTCATGGGGTGGGGGTGGAGG - Intergenic
1054703899 9:68443343-68443365 CTGCCAGGGGCTAGGGGTGGAGG + Intronic
1055276328 9:74621270-74621292 TTGCCATGGGTTTGGAGTGGAGG - Intronic
1055460213 9:76512287-76512309 TTGCCAGCGGCTGGGCGTGGGGG - Intergenic
1055617569 9:78088887-78088909 CTGTCATGGGGTTGGGGTGATGG + Intergenic
1056891420 9:90497071-90497093 CTGTCAGGGGGTTGGGGAGAGGG + Intergenic
1057117450 9:92539353-92539375 CAGGCAGTGGGTTGGGGTGGGGG - Intronic
1058133939 9:101286525-101286547 CAGGCAAGGGGTTGGGGTGGGGG + Intronic
1059445621 9:114336277-114336299 CTGCCACGGGGTAGGGGTGCGGG + Exonic
1059551960 9:115237901-115237923 CAGCCAGGGGGTTGGCAGGGAGG - Intronic
1061079457 9:128361292-128361314 GGGCCAGGGGGTTGGCGTGGGGG - Exonic
1061310844 9:129761352-129761374 TTGCCAGCGGGTAGGCGGGGTGG + Intergenic
1061370882 9:130196788-130196810 CTGCCATGGGGATGAGGTGGGGG - Intronic
1061450525 9:130664815-130664837 CTGTCTTGGGGCTGGCGTGGTGG - Exonic
1061596250 9:131631335-131631357 CTGCCAGGGGCTGGGGGTCGAGG - Intronic
1062035332 9:134380292-134380314 CTGCCCGTGGCTTGGCCTGGGGG + Intronic
1062375360 9:136259534-136259556 CTGCCAGGGGGTGGGGGATGGGG + Intergenic
1062444364 9:136587515-136587537 CTGCCTGGAGGCTGGGGTGGAGG - Intergenic
1062728638 9:138095930-138095952 TTGCCAGGGGGTTGGGGGGGCGG + Intronic
1186589784 X:10917664-10917686 ATGCCAGGGGGTTGGGGAAGAGG + Intergenic
1186822136 X:13300317-13300339 TTGCCAGGGGATTGGGATGGGGG - Intergenic
1186914039 X:14200837-14200859 CTGCCGGGGGGTTGGGGGAGGGG - Intergenic
1186931880 X:14402253-14402275 CTGCCATTGGGTTGGTGTGGGGG - Intergenic
1187393866 X:18903658-18903680 CTGCCAGGGGCTGGAGGTGGAGG + Intronic
1187473183 X:19587319-19587341 CTGCCAGGGGCTGGGAGAGGGGG + Intronic
1187481260 X:19657902-19657924 TTGCCAGGGGCTGGGGGTGGGGG + Intronic
1187575773 X:20553083-20553105 TTGCCAGGGGCTGGGTGTGGGGG - Intergenic
1187615268 X:20987076-20987098 CTGGCCGGGCGTAGGCGTGGTGG + Intergenic
1187674952 X:21707102-21707124 TTGCCAGGGGCTTGGGGTGGGGG - Intronic
1187911026 X:24111318-24111340 CTGCCTGGGGACAGGCGTGGTGG + Intergenic
1187925891 X:24249797-24249819 GAACCAGGGGCTTGGCGTGGTGG - Intergenic
1188003742 X:25003627-25003649 CTCCCGGGGGGTGGGGGTGGGGG + Intergenic
1188004178 X:25005855-25005877 CTCCAAGGCGGTGGGCGTGGGGG - Intronic
1188255683 X:27959971-27959993 CTGTCGGGGGGTGGGGGTGGGGG - Intergenic
1189137529 X:38564143-38564165 CTGGCAGGGGGTGGGCATGAGGG - Intronic
1189637870 X:43031420-43031442 CTGTCATGGGGTTGGGGTGGGGG + Intergenic
1190093374 X:47459453-47459475 TTGCCAGGGCCTGGGCGTGGAGG + Intronic
1190187288 X:48246370-48246392 TTGCCAGGGGTTAGGAGTGGTGG - Intronic
1190325470 X:49204652-49204674 CTGCCAGGGGAGAGGCCTGGAGG - Intergenic
1190399398 X:50016741-50016763 TTGCCAGGGGTTTAGGGTGGGGG - Intronic
1190580474 X:51888948-51888970 CTGCCAGGGGTTAGGGATGGGGG + Intronic
1190581087 X:51893722-51893744 CAGCGAGGGGGTTGGGGTTGGGG + Exonic
1191701822 X:64050237-64050259 CTGCTAGGGGGATTGGGTGGAGG + Intergenic
1192167098 X:68833066-68833088 CTACAAGGGGGTGGGGGTGGGGG + Intronic
1192261537 X:69508706-69508728 CTGCCAGGGAGGTGGGGTGAGGG - Intronic
1192327314 X:70143719-70143741 ATGCCTGGGGGTTGGGGGGGCGG + Intronic
1192467309 X:71366493-71366515 ATGTGAGGGGGTGGGCGTGGGGG + Exonic
1193159312 X:78209933-78209955 CTGTCAGGGGGTTGGGGGGAGGG + Intergenic
1193194242 X:78611154-78611176 TTGTCAGGGGGTGGGGGTGGAGG - Intergenic
1194002361 X:88446267-88446289 TTACCAGGGGCTTGGGGTGGGGG + Intergenic
1194922096 X:99779194-99779216 CTGCTAGGGGGTGGGTGTGCAGG + Intergenic
1196062114 X:111420312-111420334 GTGCCAGGGGTTAGGTGTGGAGG + Intergenic
1196092979 X:111766698-111766720 CTGTCATGGGGTGGGGGTGGGGG - Intergenic
1197339006 X:125243353-125243375 CAGGCAGGGGCTTGGCATGGTGG + Intergenic
1199691655 X:150313299-150313321 CTGCCATGGTGCTGGTGTGGTGG + Intergenic
1200126837 X:153819208-153819230 CTCCGACGGGGTTGGCGGGGCGG - Intronic
1200155353 X:153972076-153972098 CTCCCAGGGCGGAGGCGTGGAGG - Intergenic
1200182769 X:154160969-154160991 GTGCCAGGGGCTGGGGGTGGGGG + Intergenic
1200188423 X:154198083-154198105 GTGCCAGGGGCTGGGGGTGGGGG + Intergenic
1200194073 X:154235223-154235245 GTGCCAGGGGCTGGGGGTGGGGG + Intergenic
1200199828 X:154273027-154273049 GTGCCAGGGGCTGGGGGTGGGGG + Intronic
1200275604 X:154729479-154729501 CTGCCAGAGGTTTGGAGTGACGG + Intronic
1201957965 Y:19647088-19647110 CTGCCAAGGGGTTGGAGAGAAGG + Intergenic
1202372027 Y:24205337-24205359 TTGCCACGGGGCTGGCTTGGGGG - Intergenic
1202498758 Y:25464779-25464801 TTGCCACGGGGCTGGCTTGGGGG + Intergenic