ID: 1179608018

View in Genome Browser
Species Human (GRCh38)
Location 21:42530820-42530842
Sequence CATTCTCTGCAGCAGGTACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 124}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179608018_1179608026 27 Left 1179608018 21:42530820-42530842 CCACGTACCTGCTGCAGAGAATG 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1179608026 21:42530870-42530892 TTAGGTGGGGCTGAGAACCCAGG 0: 1
1: 0
2: 0
3: 15
4: 172
1179608018_1179608021 0 Left 1179608018 21:42530820-42530842 CCACGTACCTGCTGCAGAGAATG 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1179608021 21:42530843-42530865 TGTCGCGTGGCTGTAGTCTTAGG 0: 1
1: 0
2: 0
3: 6
4: 112
1179608018_1179608025 14 Left 1179608018 21:42530820-42530842 CCACGTACCTGCTGCAGAGAATG 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1179608025 21:42530857-42530879 AGTCTTAGGCAACTTAGGTGGGG 0: 1
1: 0
2: 0
3: 7
4: 67
1179608018_1179608027 28 Left 1179608018 21:42530820-42530842 CCACGTACCTGCTGCAGAGAATG 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1179608027 21:42530871-42530893 TAGGTGGGGCTGAGAACCCAGGG 0: 1
1: 0
2: 0
3: 18
4: 212
1179608018_1179608022 9 Left 1179608018 21:42530820-42530842 CCACGTACCTGCTGCAGAGAATG 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1179608022 21:42530852-42530874 GCTGTAGTCTTAGGCAACTTAGG 0: 1
1: 0
2: 0
3: 10
4: 111
1179608018_1179608024 13 Left 1179608018 21:42530820-42530842 CCACGTACCTGCTGCAGAGAATG 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1179608024 21:42530856-42530878 TAGTCTTAGGCAACTTAGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 64
1179608018_1179608023 12 Left 1179608018 21:42530820-42530842 CCACGTACCTGCTGCAGAGAATG 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1179608023 21:42530855-42530877 GTAGTCTTAGGCAACTTAGGTGG 0: 1
1: 0
2: 0
3: 11
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179608018 Original CRISPR CATTCTCTGCAGCAGGTACG TGG (reversed) Intronic
900339565 1:2181558-2181580 CCATCTCTGCAGCTGGCACGTGG - Intronic
900807270 1:4775768-4775790 CCTTTGCTGCAGCAGGTAAGAGG + Intronic
901243999 1:7714191-7714213 CATTCTCTTCTGCAGGTCAGTGG - Intronic
901371743 1:8804693-8804715 CATTCTCACCAGCAGGAAGGAGG - Intronic
902039872 1:13484812-13484834 CAAACTCTGCAGCTGGTACTGGG + Intronic
905010612 1:34744649-34744671 CCCTCTCTCCAGCAGGTGCGGGG + Intronic
907185089 1:52602941-52602963 CATTTTCTGCATCTGGAACGGGG + Intronic
909495919 1:76278591-76278613 CATTCTCTGCATCAGGGATTTGG - Intronic
910749794 1:90616599-90616621 CATTCTCTGGAGCAGTTGCTGGG + Intergenic
914190806 1:145408780-145408802 CATGCAATGAAGCAGGTACGAGG - Intergenic
914363424 1:146956625-146956647 CATGCAATGAAGCAGGTACGAGG + Intronic
914488253 1:148130509-148130531 CATGCAATGAAGCAGGTACGAGG - Intronic
920703372 1:208234393-208234415 CATTTTCTGCAGCAGGCTCTTGG + Intronic
923251084 1:232180286-232180308 CAACCTCTGCAGCAGCCACGTGG - Intergenic
1066063485 10:31744983-31745005 CATGGTCTTCAGCAGCTACGTGG + Intergenic
1066436186 10:35398227-35398249 CATTCTCTGCAGTGAGTATGGGG + Intronic
1068473320 10:57493150-57493172 CATTCTCATCAACAGGTATGAGG - Intergenic
1073466385 10:103696787-103696809 CATTCTCTGCAGCTGGTCCAGGG + Intronic
1075131986 10:119748249-119748271 CAGTTTCTGCTGCAGGTACTGGG + Intronic
1076200385 10:128553086-128553108 CATTCAGTGCAGCAGTTACGAGG - Intergenic
1076586193 10:131549273-131549295 CCTTCTGTGCAGCAGGTCCTGGG - Intergenic
1079259424 11:18864039-18864061 GATGCTCTGCAGCAGGGACAGGG + Intergenic
1083016894 11:59463345-59463367 CATTCTCTGGAGCAGATGAGAGG + Intergenic
1083655163 11:64225999-64226021 CCCTCTCTGCAGCAGGGACTTGG - Intronic
1083759452 11:64807721-64807743 CATTCCCTGAAGCAGGCACAGGG - Intronic
1084455666 11:69266816-69266838 CTTTCTCTGCACCAGGTGCAGGG - Intergenic
1090099885 11:123783080-123783102 CATTCACTGCTGCAGTTACCTGG - Intergenic
1092559360 12:9594426-9594448 AATTCTCTTCAGCAGGTCTGGGG + Intergenic
1094452385 12:30596535-30596557 CACTCTCTGCAGCATCTACAAGG + Intergenic
1098066585 12:66624600-66624622 TATCCTCTGCAGCAAGTACTAGG + Intronic
1101243601 12:102863116-102863138 CAATCTGTGCAGCTGCTACGTGG + Intronic
1102657802 12:114497679-114497701 CAGTCTCTCCACCAGGTACTTGG + Intergenic
1102991872 12:117321860-117321882 CTTTCTCTACAGCAGGGAAGAGG - Intronic
1103376088 12:120457176-120457198 CATTCTGGGCAGCACGTACCTGG - Exonic
1105356149 13:19661817-19661839 CCTTCTCTGCAGCATGAATGAGG - Exonic
1119193490 14:72700655-72700677 CAGAATCTGCAGCAGGTAAGTGG + Intronic
1121007573 14:90500145-90500167 CTTTCTCTGCACCAGGCACTGGG - Intergenic
1121742441 14:96263777-96263799 CACTCTGTGCAGCAGGTCCCAGG - Exonic
1122220585 14:100236879-100236901 TATTTTCTGGAGCAGGTACTAGG + Intergenic
1122446745 14:101775408-101775430 CAATCTGTGCAGCAGATACATGG - Intronic
1127220192 15:56871990-56872012 CATTTTCTGCAGCTGGTGAGTGG - Intronic
1127613431 15:60659024-60659046 AATGCTCTGCAGCAGGTTTGCGG - Intronic
1132502830 16:292165-292187 CATCGTGTGCAGCAGGTCCGAGG - Intronic
1132534624 16:471955-471977 CATTTTCTGCTGCAGCCACGTGG - Intronic
1135975065 16:27103320-27103342 CATTTTCAGAAGCAGGTACCAGG + Intergenic
1137644117 16:50059410-50059432 CAGTCCCTGCAGCAGGTGCTAGG - Intergenic
1138445170 16:57059004-57059026 CAGTGTCTCCAGCAGGTACAGGG - Exonic
1139291559 16:65863212-65863234 CATTCTCTGTAGCAGGCAGTAGG - Intergenic
1147205606 17:38835322-38835344 CATTCTCTCCAGCAGGTGACTGG - Exonic
1147612119 17:41807999-41808021 CATTCACTGCAGCAGGACAGGGG + Exonic
1147919599 17:43907656-43907678 CTTTCCCAGCAGCTGGTACGGGG + Intronic
1148449563 17:47767322-47767344 CATTCTCTGCCCCAGGTCTGTGG - Intergenic
1155253406 18:23972438-23972460 CATACTCTGCTCCAGGTACCTGG - Intergenic
1158676212 18:59520880-59520902 CATCCACTGCTGCAGGTAGGAGG - Intronic
1163723783 19:18911066-18911088 CTTCCTCTGCAGTAGGGACGAGG + Exonic
1165223823 19:34339890-34339912 GCTTCTCTGCAGCAGGGACATGG - Exonic
1167199264 19:48052912-48052934 CTTTCTCTGCAACAGGCAGGAGG - Intronic
1167682425 19:50932206-50932228 CAATTTCTGCAGCCGGTACTTGG - Intergenic
1168161393 19:54512754-54512776 CTTACACTGGAGCAGGTACGGGG - Intergenic
925165760 2:1714614-1714636 CTGTCTCTGCAGCAGGAATGCGG + Intronic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
932754100 2:74393144-74393166 CATTATCTGTAGCAGGCAAGGGG - Intergenic
933831506 2:86213858-86213880 CATCCTATGCAACAGGCACGGGG + Intergenic
935614390 2:105061440-105061462 GAGTCTCTGCCGCAGGTATGAGG - Intronic
943498977 2:188662536-188662558 CATTCTCATCAGCAGATATGAGG + Intergenic
943728570 2:191277763-191277785 CCTTCTCAGCTGCAGGTACAGGG - Intronic
946001823 2:216488844-216488866 CATTCTGTGCTGCAGGTCCTGGG - Intergenic
946010582 2:216560477-216560499 CATTTTCTGCAGCGGCTACTGGG + Intronic
1169100002 20:2939366-2939388 CATTCTCTGCAGCTGTAACATGG + Intronic
1173618325 20:44417384-44417406 CATTCTCTGCAGGGGGTACAAGG - Intronic
1173793740 20:45844306-45844328 CATTCTCTGCAGCTGGCTCAGGG + Exonic
1174640936 20:52043608-52043630 CATTTTCTGCAGCATGTACTGGG - Intergenic
1176103801 20:63376418-63376440 CTTCCTCTGCAGCAGGGACTGGG - Intronic
1179608018 21:42530820-42530842 CATTCTCTGCAGCAGGTACGTGG - Intronic
1185333727 22:50262468-50262490 CACTCTCTCCAGCAGGGATGGGG + Intergenic
950688955 3:14640515-14640537 CATTCCCTCCTGCAGGTGCGTGG - Intergenic
952485247 3:33803250-33803272 CATTCTCATCAGCAGGTATATGG + Intronic
953669941 3:44953843-44953865 CATTCACTGCATCAGGTTAGGGG - Intronic
953673296 3:44980572-44980594 CTTTCACTGCAGCAGGAAGGTGG - Intronic
956674889 3:71724833-71724855 CTCTCCCTGCAGCAGGGACGCGG + Intronic
957670827 3:83300659-83300681 CATTCACAGCAGCAGGATCGTGG + Intergenic
958085933 3:88806887-88806909 CACTCTCAGCAGCAGGAAGGTGG - Intergenic
969288442 4:6222663-6222685 CATTCTAGCCAGCAGGAACGAGG + Intergenic
969649898 4:8459852-8459874 CAGTGTGTGCAGCAGGTTCGAGG + Intronic
971314418 4:25555307-25555329 AACTCTCTGCAGCAGGCAGGAGG - Intergenic
981055554 4:140357507-140357529 CATTCACTGCAGGAGGTGCCAGG - Intronic
982968665 4:161950167-161950189 CATTCTCTTCAGCAGGACCTGGG + Intronic
983873625 4:172851051-172851073 CATTCTCTGGAGAAGGAAGGGGG - Intronic
984877914 4:184385818-184385840 CATTCTCTGCAGCCAGTACCTGG - Intergenic
988092803 5:26564745-26564767 CATTCTCTGGACCAGTTACTTGG - Intergenic
989214375 5:38888830-38888852 CATTTTCTGAAGAAGGTACTAGG - Intronic
991970312 5:72134762-72134784 CATTTTCTGCAGCAGGGCCCAGG - Intronic
992980163 5:82161412-82161434 TATTCTCTGGAACAGGTAGGAGG - Intronic
997003631 5:129792606-129792628 CATTCTCTGCAGGAGTAAGGTGG + Intergenic
998475020 5:142413171-142413193 CATCCTCTGAAGCAGGTAGTAGG + Intergenic
1002053434 5:176584825-176584847 CATTCTCTGCACCAAGGCCGGGG + Exonic
1002578852 5:180195047-180195069 TGTTCTCTGCAGCAGGCACTGGG - Intronic
1007224687 6:40304688-40304710 CATACTCTGCAGCAGGGTCATGG + Intergenic
1009935746 6:70232664-70232686 CATTCTCTCCAGGAGGGCCGGGG + Exonic
1018057980 6:160068833-160068855 TACTCTCTGCAGCATGGACGTGG + Intronic
1018340846 6:162849420-162849442 CTTTCTCAGCAGCAGGCACTGGG - Intronic
1018604535 6:165583677-165583699 AAGTCTCAGCAGCAGGTAGGTGG + Intronic
1019530018 7:1498699-1498721 CATGCTGTGCATCAGGTGCGTGG - Exonic
1020373574 7:7461019-7461041 CATTCCCTTCAGCAAGTCCGTGG - Intronic
1022969769 7:35506058-35506080 CTTACTCTGCAGCAGGCACCAGG + Intergenic
1023476791 7:40588454-40588476 CATTATCTACAGGAGGTAAGGGG + Intronic
1023621707 7:42079759-42079781 AATTCTCTCCACCAGGTAAGTGG + Intronic
1023777101 7:43618187-43618209 CATGCTGTGGAGCAGGGACGGGG + Intronic
1024274393 7:47666231-47666253 CAAACCCTGCAGCAGGTAAGGGG - Intergenic
1025067694 7:55872048-55872070 CTTTCTCTCCAGGAGGTATGCGG - Intergenic
1027405527 7:77855836-77855858 CATTCCCAGCAGCAGCCACGTGG - Intronic
1030104412 7:105974866-105974888 CATTGCCTGTAGCAGGTAAGAGG - Exonic
1034589333 7:152126851-152126873 AATTCTCTAAAGCAGGTAGGAGG + Intergenic
1035285572 7:157804465-157804487 CATTCTCTGGAGCAGCTGCATGG - Intronic
1035373395 7:158393038-158393060 CCTTCTCTGCAGCAGGCACAGGG - Intronic
1035774130 8:2174272-2174294 CTTCCTCAGCAGCAGGGACGGGG - Intergenic
1039662047 8:39478386-39478408 CATTCTCTGCAGAAAGGAAGAGG - Intergenic
1039782182 8:40796662-40796684 CAGTCTCTGCAGCAGCTGTGCGG - Intronic
1040398886 8:47027638-47027660 CATTCTATGCAACATGTAAGAGG + Intergenic
1042436262 8:68768769-68768791 CATTCTCTTCAGCTGCCACGTGG + Intronic
1042793589 8:72635529-72635551 CAATCTCAGCAGCAGAGACGGGG - Intronic
1044404618 8:91813719-91813741 CATCTTCTGCAGCAAGTACCGGG + Intergenic
1045261659 8:100580599-100580621 CATTCTAGGCAGCAAGTATGAGG - Intronic
1047071463 8:121348801-121348823 CTCTCTCTGCAGCTGGCACGTGG - Intergenic
1057368693 9:94449606-94449628 CATTCTCACCAGCAAGTATGAGG - Intronic
1057813612 9:98277555-98277577 CATTCTCATCAGCATGTATGAGG - Intergenic
1061688891 9:132308206-132308228 CATCAGCAGCAGCAGGTACGTGG - Intronic
1062284930 9:135768634-135768656 CATCCTCAGCAGCAGGAACGAGG + Exonic
1187552646 X:20321638-20321660 CATTCTAGGCAGAAGGTACATGG + Intergenic
1187558327 X:20374322-20374344 CATTTTCAGCAGCAGGTATGAGG + Intergenic
1190554300 X:51618258-51618280 CAGCTTCTGCAGCAGGTGCGGGG - Intergenic
1190560595 X:51682216-51682238 CAGCTTCTGCAGCAGGTGCGGGG - Intergenic
1190563696 X:51711105-51711127 CAGCTTCTGCAGCAGGTGCGGGG + Intergenic
1191185127 X:57603304-57603326 CTTTCTCTGCAGCAGGAGAGGGG + Intergenic
1193896927 X:87126445-87126467 CATTCTTTGCAGCAGCCACGTGG + Intergenic