ID: 1179609344

View in Genome Browser
Species Human (GRCh38)
Location 21:42539812-42539834
Sequence GCTTAGAAATTCCAGCAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 204}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179609340_1179609344 30 Left 1179609340 21:42539759-42539781 CCTGTCGGAAGTCAGGGTCAGCT 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1179609344 21:42539812-42539834 GCTTAGAAATTCCAGCAACCAGG 0: 1
1: 0
2: 0
3: 22
4: 204
1179609341_1179609344 -6 Left 1179609341 21:42539795-42539817 CCTTCCCTTTCTCTTCTGCTTAG 0: 1
1: 0
2: 4
3: 65
4: 698
Right 1179609344 21:42539812-42539834 GCTTAGAAATTCCAGCAACCAGG 0: 1
1: 0
2: 0
3: 22
4: 204
1179609342_1179609344 -10 Left 1179609342 21:42539799-42539821 CCCTTTCTCTTCTGCTTAGAAAT 0: 1
1: 0
2: 9
3: 88
4: 645
Right 1179609344 21:42539812-42539834 GCTTAGAAATTCCAGCAACCAGG 0: 1
1: 0
2: 0
3: 22
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179609344 Original CRISPR GCTTAGAAATTCCAGCAACC AGG Intronic
901306362 1:8235875-8235897 GCTGAGAAATTCCAGTGACGTGG + Intergenic
905845044 1:41222620-41222642 GCTTAGAAAATCCAGACACCTGG + Intronic
906160579 1:43646324-43646346 GCTTGGAAATTCCAGCACTTTGG + Intergenic
909732908 1:78917558-78917580 GCTTAAAATTTCCAGCAATAAGG - Intronic
915723911 1:158003999-158004021 GCTTCCCAATTCCAGGAACCGGG - Intronic
915883639 1:159700564-159700586 GCTTTCAAAATCCAGCAACAGGG - Intergenic
916479788 1:165204601-165204623 GCTGAGAAATCACTGCAACCAGG + Intronic
916926701 1:169528858-169528880 GCTGTGAAATTTCAGAAACCAGG + Intronic
917022298 1:170602354-170602376 GCTTAGAAATTTCTTCCACCAGG + Intergenic
923887620 1:238176701-238176723 GCATAGAAATTCTAGTTACCAGG - Intergenic
923933435 1:238730545-238730567 TTTTAGAAATTCCAGTAACCTGG + Intergenic
924770596 1:247076554-247076576 GCTTAGAAATTCAGGCACACAGG - Intronic
1063205615 10:3827715-3827737 GTTGGGAAATTCCAGCAACAGGG + Intergenic
1063262805 10:4409432-4409454 TCTGAGAAATTCCAGCACACTGG + Intergenic
1063667024 10:8068625-8068647 GCTTATAAATCCCAGCTACTCGG + Intronic
1065667980 10:28083398-28083420 GCTTGGAAATTTCAGCCCCCTGG - Intronic
1067940643 10:50652298-50652320 ACTGAGAATTTCCAGCCACCAGG - Intergenic
1068369068 10:56090652-56090674 GCTTAGAAATTTCTTCCACCTGG - Intergenic
1069991397 10:72318838-72318860 GCTTTGAATTTCCAGCAAGCAGG - Intergenic
1070673602 10:78396407-78396429 ACGTAGAAATTCAAGGAACCTGG - Intergenic
1072564301 10:96604752-96604774 GCTTAGGAATTCTAGCAAACAGG + Intronic
1073398654 10:103239116-103239138 GCTCAGAAATGCCAACAAACTGG - Intergenic
1081270597 11:41077936-41077958 GCTTAGAAATTTCTTCAACCAGG + Intronic
1081698507 11:45136599-45136621 GCTTAGAAATGGCAAGAACCAGG + Intronic
1081834388 11:46142295-46142317 GCTTTGTAATCCCAGCAACTTGG - Intergenic
1082711692 11:56560679-56560701 GCTTAGAAATTTCTTCCACCAGG - Intergenic
1082766264 11:57170205-57170227 GCTTAGAAATTTCTTCCACCAGG + Intergenic
1085450773 11:76630804-76630826 GCTTATAAATCCCAGCAACTTGG + Intergenic
1085877082 11:80421428-80421450 GATAAGAAATTTCAGCAACAGGG + Intergenic
1090052857 11:123395653-123395675 GTTTAGAAATTCCAACATCCAGG + Intergenic
1091187689 11:133661209-133661231 GCTTAGAATTTCCAGGGACCTGG - Intergenic
1093212991 12:16329351-16329373 ATTTAGAAATGACAGCAACCAGG - Intergenic
1094066413 12:26365258-26365280 GCTTAGTGATTCCTGAAACCTGG + Intronic
1095155897 12:38853118-38853140 GCTAATACATTCCAGCATCCAGG - Intronic
1098152496 12:67561490-67561512 GCTTAGAAAATCCAGGATCATGG + Intergenic
1098741640 12:74179672-74179694 GCTTAGAAATTTCTTCCACCAGG + Intergenic
1100597791 12:96086825-96086847 GCTTAGAAATTTCTTCCACCAGG - Intergenic
1100898763 12:99215003-99215025 GCTTAGAAATTTCTTCCACCAGG - Intronic
1103341522 12:120223659-120223681 GCTTAGAAATCTCAGGGACCTGG - Intronic
1103807242 12:123583276-123583298 TACTAGAGATTCCAGCAACCTGG + Intergenic
1104973521 12:132541918-132541940 GCCCAGAAACTCCAGCAACCCGG - Intronic
1105520411 13:21126117-21126139 GGTTTGAAATTCAAGCAGCCAGG - Intergenic
1109407386 13:61919347-61919369 GCTTAGAAATTTCTTCAGCCAGG + Intergenic
1110342039 13:74403040-74403062 GCTTAGAAATTTCTTCCACCAGG + Intergenic
1112808597 13:103190358-103190380 GCCTAGAAATTAAAGCAAGCAGG - Intergenic
1113839821 13:113352833-113352855 GCTTAGTAATTGGAGCCACCTGG - Intronic
1115984389 14:39088821-39088843 GCTCAGGAATTCAAGCAGCCTGG + Intronic
1116319155 14:43437497-43437519 GCTTAGAAATTACTTCAACTTGG - Intergenic
1116451608 14:45072723-45072745 GCTTAGAAGTTCCAGAGACTGGG - Intronic
1116663988 14:47751172-47751194 GCTGAGAAAATCCTGAAACCTGG + Intergenic
1117715106 14:58572330-58572352 CCTGAGCAATTCCAGCAACCTGG - Intergenic
1118495753 14:66306647-66306669 GCCTAGAAATAACAGCAAGCAGG + Intergenic
1118633192 14:67724698-67724720 GACTAGAAATTCAAGGAACCTGG + Intronic
1120406994 14:84102838-84102860 GCTTAGAAATTTCTTCCACCAGG - Intergenic
1120818983 14:88894533-88894555 ACTAAGAATTGCCAGCAACCTGG - Intergenic
1120897506 14:89546907-89546929 GCTTTGTAATTCCAGCTATCTGG - Intronic
1122490229 14:102110333-102110355 GCTTAGAAATTTCTTCCACCAGG - Intronic
1123479766 15:20620259-20620281 GATTAGAAATTCCAGAAGCCCGG + Intergenic
1123638240 15:22380105-22380127 GATTAGAAATTCCAGAAGCCTGG - Intergenic
1125153552 15:36561543-36561565 GCTTAGAAATTTCTTCTACCAGG - Intergenic
1127145066 15:56015170-56015192 GCTTAGAAATTTCTTCCACCAGG + Intergenic
1128476956 15:68005635-68005657 GCTTAGAAATTTCTTCCACCAGG - Intergenic
1128931320 15:71707116-71707138 GCCTAGAAGTCCCAGCAATCAGG + Intronic
1130416832 15:83702180-83702202 GCTTAGAAATTTCTTCCACCGGG - Intronic
1131200554 15:90392206-90392228 GCTTAAAACTTCCAGGAAACTGG + Intronic
1132121912 15:99183637-99183659 GCTTAGAAATTTCTTCCACCAGG - Intronic
1132412429 15:101592850-101592872 GCTCAGCATTTGCAGCAACCTGG - Intergenic
1133560324 16:6944656-6944678 GCCTAGAAAGTGCAGGAACCTGG + Intronic
1135270122 16:21061910-21061932 GCGTATAAACTGCAGCAACCAGG - Intronic
1135603516 16:23803002-23803024 GCTTAGCAGGGCCAGCAACCAGG - Intergenic
1135883915 16:26286696-26286718 GCTTTGAGATTCCAGAAGCCAGG + Intergenic
1138267449 16:55669886-55669908 GCATAGAAATTCTGGAAACCTGG + Intronic
1139085350 16:63578160-63578182 GCTTAGGAATGCCAGCATCATGG + Intergenic
1141272988 16:82557851-82557873 GCTTAGAAATTTCTTCCACCAGG - Intergenic
1143498961 17:7327813-7327835 GCTTGGAAAGTCCAGCACACTGG + Exonic
1144013501 17:11172221-11172243 GTGTAGAAATTCCAGCACACAGG + Intergenic
1145218386 17:21069252-21069274 GCTTTGGAATTCCAGGAACTGGG - Intergenic
1145975193 17:28979789-28979811 CCTGAGAAATTCCAGCTACAAGG + Exonic
1146571759 17:33958903-33958925 GCTTAGAAATTTCTTCCACCAGG + Intronic
1149568772 17:57657510-57657532 TCTTAGAATTTCCAGCCACAGGG - Intronic
1151106031 17:71618302-71618324 GCTTAGAAATTTCTTCTACCAGG - Intergenic
1152893251 17:82895057-82895079 GCTTAGAAACCTCAGCAACAAGG - Intronic
1155764028 18:29605246-29605268 GCTTAGAAATTTCTTCCACCAGG - Intergenic
1156817463 18:41328211-41328233 GCTTAGAAATTTCTTCCACCAGG - Intergenic
1158833194 18:61302982-61303004 GCTTAGAAATTTCTTCCACCAGG - Intergenic
1159474623 18:68904356-68904378 GCTTAGCACTTCCTGCAAGCAGG - Intronic
1159617461 18:70598199-70598221 GCTTAGAAATTTCCTCCACCTGG - Intergenic
1166114534 19:40645413-40645435 GCCTGTAAATTCCAGCAACTTGG + Intergenic
1166406364 19:42524782-42524804 CCTTAGAGACCCCAGCAACCAGG + Intronic
1166718823 19:44985983-44986005 GCTTAGAGATTCCGCCACCCAGG - Intronic
1166847241 19:45736305-45736327 GCTTAGTAATTCCAGCACTTTGG - Intronic
1167667952 19:50833585-50833607 GCTTATAAATTCAGGCATCCTGG - Intronic
928922984 2:36544783-36544805 GCTTAGAAGTTCCAGATACCAGG - Intronic
932936329 2:76107217-76107239 GCTCAGAAATTCCCAGAACCTGG + Intergenic
933374736 2:81464961-81464983 GCCTACAGATTTCAGCAACCAGG - Intergenic
934072145 2:88394106-88394128 GCTTAGAAATTTCTTCCACCTGG - Intergenic
935239688 2:101167784-101167806 GCTTAGAAATTTCTTCCACCAGG - Intronic
936098233 2:109550748-109550770 ACTTAAAAATTCCCTCAACCAGG + Intronic
936784473 2:116077280-116077302 GTTTAGTAATTACTGCAACCAGG - Intergenic
938194151 2:129311562-129311584 GGTTAAAAATTGCAGCAACATGG - Intergenic
938819882 2:134946444-134946466 ACGTAGAAATTCGAGCAACTTGG + Intronic
939079113 2:137638869-137638891 GCTTAGAAATTTCTTCCACCAGG - Intronic
939300297 2:140328998-140329020 TCTTAGAAATTGCTGCAATCTGG + Intronic
940691716 2:156926950-156926972 GCTTAGAAATTTCTTCCACCAGG + Intergenic
940705092 2:157094857-157094879 ACTGAGAGATTCCAGCACCCTGG - Intergenic
941346179 2:164372115-164372137 GCTTAGAAATTCCTTCTACCAGG - Intergenic
941525251 2:166598545-166598567 GCTTAGAAATTTCTTCTACCAGG + Intergenic
944104364 2:196063374-196063396 ATTAAGAAATTCCTGCAACCTGG - Intronic
944418455 2:199502752-199502774 GTTTCGTAACTCCAGCAACCAGG - Intergenic
945357771 2:208859369-208859391 GCTTAGAAATTTCTTCCACCAGG - Intergenic
945900604 2:215533607-215533629 GCTTAGAAATTTCTTCCACCAGG - Intergenic
946487387 2:220113989-220114011 GCTTTGAAGTGCCAGCAACAGGG - Intergenic
1172046089 20:32081270-32081292 GCACAGAAATTCCAGGAAGCTGG - Intronic
1174593731 20:51667285-51667307 TCTTAAAAATACCAGCAACATGG + Intronic
1175555990 20:59857297-59857319 GCTTAGAAATTTCTTCGACCAGG - Intergenic
1177268167 21:18810581-18810603 GCTTAGAAATTTCCTCCACCAGG + Intergenic
1177803157 21:25848177-25848199 GCTTAGAAATTTCTTCCACCAGG - Intergenic
1178762439 21:35416419-35416441 TAATAGAAATTCCAGGAACCCGG + Intronic
1179563695 21:42233410-42233432 TCTGAGCACTTCCAGCAACCAGG + Intronic
1179609344 21:42539812-42539834 GCTTAGAAATTCCAGCAACCAGG + Intronic
1180339293 22:11605551-11605573 GCTTAGAAAGGGCAGCACCCTGG + Intergenic
1181793333 22:25284578-25284600 GCTTAAAATTTCCAGCAAATGGG + Intergenic
1183986005 22:41570863-41570885 GCTTGTAAATTCCAGCTACTTGG + Intronic
1184350663 22:43941654-43941676 GCTTAGAAATTGCAGTGCCCTGG - Intronic
1185189820 22:49428059-49428081 GCGTGGAACTTCCAGAAACCCGG + Intronic
1185268196 22:49915962-49915984 TATTAAAAATTCCAGCAGCCGGG + Intronic
950514232 3:13453747-13453769 GCTTAGAAATTCCAGAGAATAGG + Intergenic
951207961 3:19944580-19944602 CTTTAGAAATGCCAGCCACCAGG + Intronic
952195973 3:31075747-31075769 ACTGAGAAGTTCCAGCACCCTGG + Intergenic
952518614 3:34131350-34131372 GCCTAGAAATTCCAGGGAGCAGG + Intergenic
954369085 3:50160880-50160902 CCTCAGAAATTCCAGGAGCCGGG - Intronic
954579552 3:51695879-51695901 TCTTAGAAATTCCTGCATCATGG + Intronic
956057563 3:65316687-65316709 GCTTATAAATTCCACCTACAGGG + Intergenic
956168275 3:66412837-66412859 CCTTAGCAATGCCAGTAACCTGG + Intronic
956375484 3:68609237-68609259 GCTTAGAAATTTCTTCTACCAGG + Intergenic
956897866 3:73682281-73682303 GCCTAGGACTTCCAGCAGCCAGG + Intergenic
957160380 3:76601955-76601977 GCTTAGAAATTTCTTCCACCAGG + Intronic
958091091 3:88877054-88877076 TCTCAGATATTTCAGCAACCTGG + Intergenic
958831704 3:99098287-99098309 GCTTAGAAATTTCTTCCACCAGG - Intergenic
959624224 3:108431989-108432011 GCTTAGAAATTCCTTCCACCAGG - Intronic
959756574 3:109906499-109906521 GCTTAGAAATTTCTTCCACCAGG + Intergenic
960492294 3:118332566-118332588 GCTTAGAAATTCCTTCTGCCAGG - Intergenic
962330995 3:134478095-134478117 TCTTAGGAATGCCAGTAACCAGG + Exonic
963339842 3:144020650-144020672 GCTTAGAAATTTCTTCAGCCCGG + Intronic
964910703 3:161776797-161776819 GCTTAGAAATTTCTTCCACCAGG - Intergenic
964918218 3:161861596-161861618 ACTCAGAAATTCAAGAAACCAGG + Intergenic
965283768 3:166789033-166789055 GTTTAGAAATTGCTGCATCCTGG - Intergenic
967910993 3:194542343-194542365 GCTCAGAAATTCCAGAGGCCTGG + Intergenic
975952276 4:79788527-79788549 GCTTAGAAATTTCTTCTACCGGG - Intergenic
979351240 4:119646601-119646623 GGTTAGAATTTCCTGCAACCTGG - Intergenic
981568920 4:146131398-146131420 CCTCAGAACTTCCAGCAGCCTGG + Intergenic
983324601 4:166237119-166237141 GAATAGAAATTACAACAACCTGG + Intergenic
984031718 4:174612563-174612585 GCTTAGAAATTTCTTCCACCAGG + Intergenic
985607625 5:866726-866748 GCTTAGAAATTTCTTCCACCAGG - Intronic
985980442 5:3457961-3457983 ACTTAGAAAGTAGAGCAACCCGG - Intergenic
987714733 5:21553239-21553261 GCATAGAGATTCCAGAAATCGGG - Intergenic
988633009 5:32951383-32951405 TCTTGGAAATTCCAGTAACATGG + Intergenic
988736884 5:34031521-34031543 GTTTAATAATTTCAGCAACCTGG - Intronic
990331297 5:54728730-54728752 GCTAAGAAATTTCAGCAAGAAGG - Intergenic
992048769 5:72925144-72925166 GCTTGTAAATTCCAGCTACTTGG + Intergenic
994694431 5:103056709-103056731 CCTTGGGAGTTCCAGCAACCAGG + Intergenic
995076887 5:107995678-107995700 GCTTAGAAATTCAAGTAATCTGG + Intronic
996149943 5:120023026-120023048 GCTTAGAAATTTCTTCTACCAGG - Intergenic
998278552 5:140782622-140782644 GCTTAGAAATTTCTTCCACCTGG - Intergenic
999433277 5:151542315-151542337 GCTCAGAAATGTCAGCATCCAGG + Exonic
1000580926 5:163034787-163034809 GCTTAGAAATTTCTTCCACCAGG - Intergenic
1000673550 5:164092175-164092197 ACTTAGAAATTCCAACAACAGGG + Intergenic
1002030284 5:176423530-176423552 GCTTAGAAATTCCTTCAGGCGGG + Intergenic
1006603889 6:35243085-35243107 GCTCAGAAAGTCCATCAACCAGG + Exonic
1008650020 6:53552436-53552458 GCTTAGAAATTTCTTCCACCAGG - Intronic
1008696905 6:54048843-54048865 ACTTAGAAATTTCAGCAAGGGGG - Intronic
1009001984 6:57728803-57728825 GCATAGAGATTCCAGAAATCGGG + Intergenic
1010007326 6:71010331-71010353 CCCTAGAAATTTCAGCTACCAGG + Intergenic
1010898140 6:81391927-81391949 GCTTAGAAATTTCTTCCACCAGG - Intergenic
1011870394 6:91885842-91885864 GCTTAGAAATTTCTTCTACCAGG - Intergenic
1013076947 6:106780258-106780280 GCTTAGAAATTTCTTCCACCAGG - Intergenic
1013088491 6:106876826-106876848 GCTTAGAAATTTCTTCCACCAGG + Intergenic
1013148095 6:107414898-107414920 CATTGGAAATTCCAGAAACCTGG + Intronic
1014032364 6:116720185-116720207 GCTTAGAAATCAGAGGAACCAGG - Intronic
1014048056 6:116916888-116916910 GCTTAGAACTTGTAGCCACCAGG - Intronic
1016420090 6:143874083-143874105 GCTTAGAAATTTCTTCCACCAGG + Intronic
1016577739 6:145589165-145589187 GCTCAGACATTCCAGCAACTTGG - Intronic
1021881615 7:25100630-25100652 TATTAGAAATTCCAGCCACAAGG + Intergenic
1024136163 7:46411529-46411551 GGTTAGAAATTCCAGAAGCCTGG - Intergenic
1024199714 7:47093771-47093793 GCTTAGAAATTCAAAGAACAGGG + Intergenic
1026292379 7:69019273-69019295 GCTTAGAAATTTCCTCTACCAGG + Intergenic
1026414002 7:70158137-70158159 GCTTAGAAATTACAGGAATGAGG + Intronic
1027586756 7:80067175-80067197 GCTTAGAAATTTCTTCCACCAGG + Intergenic
1027831553 7:83183434-83183456 GCTTAGAAATTTCTTCCACCAGG + Intergenic
1029368831 7:100134541-100134563 TCTTAGAAATTCCAGACATCCGG + Intergenic
1029942917 7:104498824-104498846 GCTTAGAAATGCCAGCTCTCAGG + Intronic
1029968556 7:104766346-104766368 TCTTAGAAAGTCCAGCCACTAGG + Intronic
1031887675 7:127257968-127257990 GCTTGGAAATTCGAGGACCCTGG - Intergenic
1033580702 7:142731332-142731354 GTCTAGTAATTCCAGCATCCAGG - Intergenic
1033760724 7:144433876-144433898 GCTTGGAAATTGCAGCATCAGGG + Intergenic
1035279424 7:157768205-157768227 GATTTGATATTCCAGCAATCTGG - Intronic
1036175821 8:6537503-6537525 GCATCGAAACTCAAGCAACCAGG + Intronic
1038396112 8:27246808-27246830 GCTTTGAACTTCCAGCCTCCCGG + Intronic
1041491421 8:58437622-58437644 GCTTAGAAATTTCTTCCACCAGG - Intronic
1043192418 8:77242336-77242358 GCTTAGAAATTTCTTCCACCAGG - Intergenic
1045246352 8:100444864-100444886 GCTTAGACATGCCTGCATCCGGG - Intergenic
1050827697 9:9969895-9969917 GCTTAGAAATGCCAGAGGCCAGG - Intronic
1052008804 9:23382291-23382313 GCTTAGAAATTTCTTCTACCAGG - Intergenic
1052026624 9:23580677-23580699 GCTTAAAATTTCCAGCAACAAGG + Intergenic
1055837683 9:80463739-80463761 GCTTAGATATTACACCATCCAGG + Intergenic
1056483489 9:87030781-87030803 CCTTAAAAATTCCTGCAGCCGGG + Intergenic
1057316543 9:93972503-93972525 GCTTAGAAATTTCTTCCACCAGG + Intergenic
1057956949 9:99417680-99417702 GATTAGAAAATCCAGAGACCAGG - Intergenic
1185797901 X:2982507-2982529 GCTTAGAAATGTTAGCAATCGGG + Intergenic
1186124021 X:6393316-6393338 GCTTGTAAATTCCAGCTGCCTGG + Intergenic
1186141399 X:6578243-6578265 GATTACAAATTCCAGCTACTCGG - Intergenic
1187345785 X:18462436-18462458 ACTCAGAAATCCCAGAAACCTGG + Intronic
1188105688 X:26144639-26144661 GCTTAGAAATTTCTTCTACCAGG + Intergenic
1189460214 X:41235622-41235644 GCTTAGAAACAGCAGCAACATGG - Exonic
1191095012 X:56664806-56664828 GCTTAGAAATTTCTTCAGCCAGG - Intergenic
1191776610 X:64821530-64821552 TCTTAGAGATTAAAGCAACCAGG - Intergenic
1192565411 X:72159236-72159258 GCTTAGAAATTTCTTCCACCAGG + Intergenic
1193911329 X:87310068-87310090 GCTTAGAAATTTCTTCTACCAGG + Intergenic
1194288272 X:92038006-92038028 GCTTAGAAATTTCTTCCACCAGG - Intronic
1194791264 X:98153410-98153432 GGCTGGAAATTCCAGCATCCAGG - Intergenic
1195070187 X:101271743-101271765 GCTAAGAAATTCCTGTCACCTGG - Intronic
1195265455 X:103175258-103175280 GGTTAAAAATTCCAGAAAACTGG + Intergenic
1196566127 X:117207087-117207109 GCTTAGAAATTTCTTCCACCAGG + Intergenic
1196968224 X:121081263-121081285 GCTTAGGAATTCCAGAAAAATGG + Intergenic
1198673608 X:139108268-139108290 GCTTAGAACTTCCAGTGATCTGG - Intronic
1199342164 X:146693764-146693786 GCTTAGAAATTAGAGGTACCAGG + Intergenic
1200605794 Y:5262571-5262593 GCTTAGAAATTTCTTCCACCAGG - Intronic