ID: 1179613869

View in Genome Browser
Species Human (GRCh38)
Location 21:42569392-42569414
Sequence CCTTCGGAGGAGCAGCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 255}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179613869_1179613883 11 Left 1179613869 21:42569392-42569414 CCTCCCTGCTGCTCCTCCGAAGG 0: 1
1: 0
2: 4
3: 37
4: 255
Right 1179613883 21:42569426-42569448 CCCGTGCGGGCTCTTTGCTCTGG 0: 1
1: 0
2: 0
3: 4
4: 67
1179613869_1179613885 28 Left 1179613869 21:42569392-42569414 CCTCCCTGCTGCTCCTCCGAAGG 0: 1
1: 0
2: 4
3: 37
4: 255
Right 1179613885 21:42569443-42569465 CTCTGGTCACACCCCGTGCCTGG 0: 1
1: 0
2: 1
3: 25
4: 218
1179613869_1179613878 -2 Left 1179613869 21:42569392-42569414 CCTCCCTGCTGCTCCTCCGAAGG 0: 1
1: 0
2: 4
3: 37
4: 255
Right 1179613878 21:42569413-42569435 GGCCAGGCTGGCCCCCGTGCGGG 0: 1
1: 0
2: 5
3: 37
4: 309
1179613869_1179613877 -3 Left 1179613869 21:42569392-42569414 CCTCCCTGCTGCTCCTCCGAAGG 0: 1
1: 0
2: 4
3: 37
4: 255
Right 1179613877 21:42569412-42569434 AGGCCAGGCTGGCCCCCGTGCGG 0: 1
1: 0
2: 0
3: 34
4: 417
1179613869_1179613886 29 Left 1179613869 21:42569392-42569414 CCTCCCTGCTGCTCCTCCGAAGG 0: 1
1: 0
2: 4
3: 37
4: 255
Right 1179613886 21:42569444-42569466 TCTGGTCACACCCCGTGCCTGGG 0: 1
1: 0
2: 0
3: 14
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179613869 Original CRISPR CCTTCGGAGGAGCAGCAGGG AGG (reversed) Intronic
900833343 1:4980605-4980627 CCTGAGGAGGGGCAGCTGGGTGG + Intergenic
900985740 1:6072028-6072050 CCTTAGGAGGTGAAGGAGGGTGG - Intronic
901810199 1:11763051-11763073 CATTTGGAGGAGCAGCCAGGGGG + Intronic
902472163 1:16656731-16656753 CTGGAGGAGGAGCAGCAGGGAGG - Intergenic
902486640 1:16750715-16750737 CTGGAGGAGGAGCAGCAGGGAGG + Intronic
902609291 1:17587930-17587952 CTTTAGGAGAAGCTGCAGGGAGG - Intronic
902628478 1:17690471-17690493 CCCTCGCAGGAGATGCAGGGCGG - Intronic
902747035 1:18481224-18481246 ACGTCGGAGGAGCAGCAAGCGGG + Exonic
903037202 1:20500598-20500620 CCTTTGGAGGAGCAGTGGTGGGG - Exonic
903500534 1:23797920-23797942 CCTGTGGAGGAGTAACAGGGTGG - Intronic
904552657 1:31332863-31332885 CCTTCGGAGGCTGAGCCGGGTGG - Intronic
905581674 1:39087106-39087128 CCTTCACAGGAGGTGCAGGGGGG + Intronic
905685455 1:39904202-39904224 CCATGGGAAGAGCTGCAGGGTGG - Intergenic
906514660 1:46431846-46431868 CCTTCTGAAGAGCAGCATGAAGG + Intergenic
907539202 1:55196858-55196880 ATGTTGGAGGAGCAGCAGGGAGG - Intronic
909246129 1:73287254-73287276 CCTTCTTAGGTGCAGCAGAGTGG + Intergenic
910347672 1:86259032-86259054 CTTTATGAGGAGCAGCAGGGAGG + Intergenic
911072827 1:93846351-93846373 CCTACGGAGGATTCGCAGGGCGG - Intronic
917484939 1:175447303-175447325 CCTTCAGAGAAGCAGGAGGAAGG - Intronic
918104042 1:181401074-181401096 CCTTGCTAGGAGCAGCAAGGAGG - Intergenic
920377852 1:205518946-205518968 CCCACTGAGGAGCTGCAGGGTGG - Intronic
920422355 1:205843704-205843726 CCTTTGGAGGAGCTGAAGAGTGG + Exonic
921708151 1:218347026-218347048 CTTTCGGAGGGGAAGAAGGGCGG - Exonic
923045249 1:230350812-230350834 CCTCCGCAGGAGCATCTGGGTGG + Intronic
923259834 1:232258136-232258158 CTTTCCAAGGAGCAGCAAGGTGG + Intergenic
924081992 1:240407750-240407772 CATTTGGAGGAGGAGCAGGCAGG - Intronic
924789121 1:247227811-247227833 CCATCACAGGAGCAGCATGGGGG + Intergenic
1064543706 10:16430632-16430654 ATTTCGGAAGAGCAGCAGTGTGG - Intergenic
1067344439 10:45427571-45427593 CGGTCGGTGGAGCTGCAGGGGGG + Intronic
1067755514 10:49001615-49001637 CATTCTGAGAAGCAGCAGGGAGG + Intergenic
1069740630 10:70685001-70685023 GCTCCGGAGGAGCCGCAGTGAGG - Intronic
1069909053 10:71748823-71748845 CCTCCCCAGCAGCAGCAGGGAGG + Exonic
1070431211 10:76340270-76340292 CTTTCGGAGGCCAAGCAGGGTGG + Intronic
1072895509 10:99362922-99362944 CCTTCAGAGGACCAGGAAGGGGG + Intronic
1074944890 10:118271758-118271780 CCTCAGCAGAAGCAGCAGGGAGG - Intergenic
1075600595 10:123765793-123765815 CTGGAGGAGGAGCAGCAGGGTGG - Intronic
1075899960 10:126033648-126033670 CCTGGTGAGGAGCAGGAGGGAGG - Intronic
1076029089 10:127142462-127142484 CCTGGGGAGGAGCAGCAGCCTGG + Intronic
1076392151 10:130111042-130111064 CCTTCACAGGAGCAGCCGTGGGG + Intergenic
1077109671 11:856552-856574 CCTGCGGCGGGGCAGCAGTGAGG + Intronic
1077377973 11:2214537-2214559 CCTGGGGAGGAGCAGCAGAGCGG - Intergenic
1077919003 11:6629577-6629599 CCTGAGGAGGGGCAGCATGGAGG + Exonic
1081898403 11:46606904-46606926 CCTTGGGAGGTGAAGCAGGTGGG - Intronic
1083174613 11:60941795-60941817 GCTTCAGAGCAGCAGCATGGGGG + Intronic
1083319800 11:61838687-61838709 CCTTTGAAGGACCTGCAGGGTGG - Intronic
1083359616 11:62097027-62097049 CCTTCAGTTTAGCAGCAGGGGGG + Intergenic
1083359819 11:62098828-62098850 CCTTCAGTTTAGCAGCAGGGGGG - Intergenic
1083396413 11:62395675-62395697 ACTTCAGAGGAGCAGGTGGGGGG - Intergenic
1083600480 11:63944409-63944431 CCTTCTGGGGACCAGCTGGGTGG + Intronic
1084098573 11:66929883-66929905 CCTAAGGAGGAGAAACAGGGAGG + Intronic
1087310305 11:96533833-96533855 CCTTGGGAGGATAAGGAGGGAGG + Intergenic
1089028287 11:115294789-115294811 CCTTGGGAGGAGGAGGTGGGTGG + Intronic
1089175512 11:116546181-116546203 CTTTCGGAGGATGAGGAGGGCGG - Intergenic
1089438456 11:118493102-118493124 CCTTCGGGGGAGCTGCGGGAAGG - Exonic
1090310355 11:125731260-125731282 GCTTCTGAGGAGCAGCTCGGAGG + Intergenic
1091950779 12:4591304-4591326 CCTTTGGGGCAGTAGCAGGGTGG + Intronic
1094370187 12:29729355-29729377 CCTTCTGATGAGAAGCAGAGTGG - Intronic
1096467043 12:51852292-51852314 ACTTGGGAGGAGGAGCTGGGTGG + Intergenic
1102054888 12:109889083-109889105 CTTTCGGAGGATGAGGAGGGAGG + Intergenic
1104780836 12:131419144-131419166 CCTAAGGAAGAGCAGCAGAGTGG - Intergenic
1104843135 12:131834163-131834185 CCATGGGAGGAGCAGGAGAGCGG + Intronic
1105270946 13:18875149-18875171 CCTTCCGAGGAGAAGCAGTGCGG - Intergenic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1105812951 13:24010719-24010741 CCCATGGAGGAGCAGGAGGGAGG - Intronic
1108493687 13:51004805-51004827 CTTAGGGAGGAGCAGCAGCGAGG - Intergenic
1109106039 13:58252326-58252348 CTTTGGGAGGACCAGGAGGGCGG - Intergenic
1110270159 13:73580231-73580253 CCTTAAGAGGAGCAGAAGAGAGG + Intergenic
1111120814 13:83846710-83846732 ACTTCTGAGGAACAGCAGGAAGG + Intergenic
1111396089 13:87671898-87671920 CCTTCGCTGGAGCAGCCGAGGGG + Intergenic
1113627286 13:111856617-111856639 CCTCCAGGGCAGCAGCAGGGCGG - Intergenic
1113722361 13:112568826-112568848 TCTTCAGAGGTGAAGCAGGGTGG + Intronic
1113785830 13:113001733-113001755 CCCTGGGAGGAGCAGCCGGCTGG + Intronic
1113924336 13:113931954-113931976 TCATCAGAGGAGCAGGAGGGTGG - Intergenic
1116229881 14:42202873-42202895 CCTTGGGAGGCGGAGGAGGGTGG + Intergenic
1118442112 14:65821534-65821556 CCTAAGGAGGTGCTGCAGGGAGG + Intergenic
1118672422 14:68143759-68143781 CCTTCAGAGGAAGCGCAGGGTGG + Intronic
1119323814 14:73746788-73746810 CCTGCAGAGCTGCAGCAGGGAGG - Intronic
1120525226 14:85569378-85569400 CCGTACCAGGAGCAGCAGGGAGG + Intronic
1121635952 14:95453978-95454000 CCTTGGGAGGCTCAGGAGGGTGG + Intronic
1121674350 14:95740472-95740494 CATTCAGAGGATCAGCAGTGGGG + Intergenic
1122296061 14:100706310-100706332 CCTGCACAGGAGAAGCAGGGCGG + Intergenic
1202906014 14_GL000194v1_random:72883-72905 CCTTCCGAGGAGGAGCGGGGCGG + Intergenic
1123474697 15:20581652-20581674 TCTTCAAAGGAGGAGCAGGGCGG - Intergenic
1123643015 15:22417442-22417464 CCTGCAGAGGAGGAGCGGGGCGG + Intergenic
1123643314 15:22418705-22418727 TCTTCAAAGGAGGAGCAGGGCGG + Intergenic
1124631258 15:31338893-31338915 CCTTAGGACAAGCAGCAGGTGGG + Intronic
1127382059 15:58438688-58438710 CCTTCTGTGGGGCAGCCGGGTGG - Intronic
1127958070 15:63870567-63870589 GCTTCGGAGGGGGAGCAGGAGGG - Intergenic
1129705488 15:77791826-77791848 ACTTGGGAGGAGCAGCTGGGAGG + Intronic
1129790071 15:78335249-78335271 CCTCTGGATGAGCAGCAGGACGG - Intergenic
1129844113 15:78760391-78760413 CCTGGGGAGGAGGAGCAGGAAGG + Intronic
1130151518 15:81315174-81315196 CATTGGGAGGAGGAGCAGGGAGG - Intronic
1132385438 15:101397032-101397054 CCTTCGGAGGAGGTGCAGGCAGG + Intronic
1132867409 16:2100309-2100331 CCTGCAGAGGCGCAGGAGGGAGG + Exonic
1135084993 16:19468216-19468238 CTTTGGGAGGCCCAGCAGGGGGG - Intronic
1135683314 16:24477560-24477582 CCTTGGGAGGCCCAGGAGGGAGG - Intergenic
1136289830 16:29264870-29264892 CCTTCCCAGCAGCATCAGGGAGG - Intergenic
1136366554 16:29811815-29811837 GCTGCAGAGGAGGAGCAGGGTGG - Intronic
1137023960 16:35455251-35455273 CCTTTGGTGGATCATCAGGGAGG + Intergenic
1142095714 16:88238346-88238368 CCTTCCCAGCAGCATCAGGGAGG - Intergenic
1142169001 16:88610542-88610564 CCGAGGGAGGGGCAGCAGGGAGG + Intronic
1142599220 17:1045116-1045138 GCTTCGGAGGAGCCGGAGGAAGG + Intronic
1142761166 17:2042613-2042635 CCTCCGGAGGAGCAGCCTCGAGG + Exonic
1143410199 17:6704056-6704078 CCTGCAGAGGAGGGGCAGGGAGG + Exonic
1144440539 17:15277270-15277292 CTTTGGGAGGAGCAGGCGGGTGG - Intergenic
1144456366 17:15422258-15422280 CTTTGGGAGGCGCAGGAGGGTGG - Intergenic
1145796532 17:27658762-27658784 CTTTTGGAGCAGCAGCTGGGTGG + Intergenic
1146845266 17:36178429-36178451 CTATCAGGGGAGCAGCAGGGGGG + Intronic
1146873480 17:36390272-36390294 CTATCAGGGGAGCAGCAGGGGGG + Intronic
1146880841 17:36441360-36441382 CTATCAGGGGAGCAGCAGGGGGG + Intergenic
1147065908 17:37922601-37922623 CTATCAGGGGAGCAGCAGGGGGG - Intergenic
1147686553 17:42289551-42289573 CCCTCTGAGGAGGGGCAGGGCGG - Intronic
1148808309 17:50275154-50275176 ACTTGGGAGGAACAGAAGGGCGG - Intronic
1150168269 17:62965929-62965951 CATTTGGAGGGGCAGCAGGGAGG - Intergenic
1152015195 17:77746212-77746234 CTTTAGGAGGGGTAGCAGGGAGG - Intergenic
1152038475 17:77888100-77888122 CCTTTGGGGGAGCAGGAGGGAGG - Intergenic
1152212119 17:79008269-79008291 CCTGCGGTGGGGCTGCAGGGAGG + Intronic
1153521168 18:5955397-5955419 CCTTCAGAGTGGGAGCAGGGAGG + Exonic
1153914662 18:9734657-9734679 CCTGCGGGGGAGCAGTGGGGTGG + Intronic
1154440965 18:14390456-14390478 CCTTAGGAGGAGCAGCAACCGGG - Intergenic
1154496130 18:14962850-14962872 CGGGTGGAGGAGCAGCAGGGAGG + Intergenic
1158125888 18:54099581-54099603 GCTTAGGAGCAGCAGCAGAGGGG - Intergenic
1160375831 18:78410749-78410771 GCTTGAGAGGAGCAGCAGAGGGG - Intergenic
1160729461 19:634354-634376 CCTGCCTAGGAGGAGCAGGGCGG + Intergenic
1161248403 19:3267683-3267705 CAATCAGATGAGCAGCAGGGTGG - Intronic
1161450425 19:4342742-4342764 CCTTGGGCGGAGCAGGAGGCAGG - Intronic
1161530140 19:4783823-4783845 CTTTGGGAGGAGAAGGAGGGAGG + Intergenic
1162117775 19:8441988-8442010 CTGTAGGAAGAGCAGCAGGGAGG + Intronic
1162562214 19:11423327-11423349 CCATCGGAGGAGCAGCAGGTTGG + Intronic
1162911730 19:13851366-13851388 CCTTTGTGGGAGCAGCTGGGGGG - Intergenic
1162965006 19:14151400-14151422 CCTGCGGGGGAGCAGCAGCGCGG - Exonic
1163779652 19:19239712-19239734 CCTGGGGAGGAGCAGGAGGGAGG - Intronic
1164063791 19:21696724-21696746 CCTCCGGCGGAGCAGCCAGGTGG - Intergenic
1165394357 19:35556241-35556263 CTGTCGGAGGAACAGCAGGGAGG + Intronic
1166343055 19:42150231-42150253 CCTGCAGAGGAGCAGAAAGGTGG - Intronic
1167694111 19:51003911-51003933 CCTTTGGAAAAGCTGCAGGGAGG - Intronic
1167711712 19:51115750-51115772 CCTGTGGTGGTGCAGCAGGGTGG + Intergenic
1168290962 19:55357386-55357408 CGGTCAGAGGTGCAGCAGGGGGG - Intronic
1202647013 1_KI270706v1_random:152495-152517 TCTTCGGAGGAGGAGAGGGGCGG - Intergenic
1202704559 1_KI270713v1_random:13525-13547 CTGGAGGAGGAGCAGCAGGGAGG - Intergenic
925179601 2:1808528-1808550 CCTCTGGAGGAGCAGGAGAGAGG - Intronic
926376606 2:12235112-12235134 CCTTGGGAGGACAAGGAGGGAGG + Intergenic
926702243 2:15811328-15811350 CCCTCGGAGGAGGAGCCTGGTGG + Intergenic
928200379 2:29244182-29244204 CCTCTGGAGGAGCGGCAGAGTGG + Intronic
930110574 2:47675446-47675468 GCTTCTGAGAAGCAGGAGGGAGG - Intergenic
931243215 2:60471007-60471029 CCACGGCAGGAGCAGCAGGGGGG - Intronic
931396503 2:61892447-61892469 CCTTGGGAGGCGGAGGAGGGTGG + Intronic
931785382 2:65613393-65613415 CCTTGGGAGGACCATCAGGCTGG + Intergenic
933834554 2:86234786-86234808 CCTTGGCAGGAACAGCTGGGTGG + Intronic
934500587 2:94857634-94857656 TCTTCCGAGGAGGAGCGGGGCGG - Intergenic
937620386 2:123978629-123978651 CCTGCCCAGGAGCACCAGGGAGG + Intergenic
937866135 2:126753027-126753049 CCTTAGGAAAAGCAGCAGGGTGG + Intergenic
937922720 2:127143228-127143250 CCTTTGGAGGAGCAGAAGGATGG - Intergenic
938337312 2:130511367-130511389 GGTGCTGAGGAGCAGCAGGGAGG - Intergenic
938352526 2:130609368-130609390 GGTGCTGAGGAGCAGCAGGGAGG + Intergenic
938548226 2:132353628-132353650 TCTTCGGAGGAGAAGAGGGGCGG + Intergenic
944243474 2:197508195-197508217 CCTTGGGAGGCCAAGCAGGGAGG - Intronic
944304324 2:198162023-198162045 CTTTCGGCAGAGCAACAGGGGGG + Intronic
947641074 2:231708145-231708167 CCTTCCGAGCAGCCGCGGGGAGG + Intronic
1168733258 20:105851-105873 CCTTCGGAGGGGCTACAGGTAGG - Intergenic
1169425630 20:5495145-5495167 CAGGAGGAGGAGCAGCAGGGAGG + Intergenic
1169552827 20:6718766-6718788 TCTTCGGAGGAGAACCAGGAAGG - Intergenic
1171877100 20:30586400-30586422 TCTTCGGAGGAGAAGAGGGGCGG + Intergenic
1171891810 20:30724336-30724358 CCTTCCGAGGAGGAGCGGGGTGG - Intergenic
1171974924 20:31588154-31588176 CCTTCTGGGGAGAAGCAGGAGGG - Intergenic
1172250767 20:33477627-33477649 CCTTCGGAGGTGGACGAGGGAGG + Intergenic
1173874651 20:46362737-46362759 CCTTCGAAGGGGCAGCAGGGAGG - Intronic
1174327001 20:49787286-49787308 CCTTCTGAGGCCCTGCAGGGTGG + Intergenic
1175257588 20:57656567-57656589 CCCTCGGAGCAGCGCCAGGGTGG + Intronic
1175328039 20:58143101-58143123 CATGCGGAGGAGCAACGGGGAGG + Intergenic
1175587231 20:60151009-60151031 CCCTAGGAGGACCAGTAGGGAGG + Intergenic
1175654855 20:60761107-60761129 TCTTCAGATGTGCAGCAGGGAGG + Intergenic
1176455084 21:6900739-6900761 CCTTAGGAGGAGCAGCAACCGGG + Intergenic
1176604856 21:8820279-8820301 TCTTCGGAGGAGGAGAGGGGCGG + Intergenic
1176625369 21:9087639-9087661 CCTTCCGAGGAGGAGCGGGGTGG + Intergenic
1176833257 21:13765787-13765809 CCTTAGGAGGAGCAGCAACCGGG + Intergenic
1176867878 21:14063829-14063851 CCTTCCGAGGAGAAGCAGGGCGG + Intergenic
1178904563 21:36625700-36625722 CCATCTGAGGAGCAGCATGTGGG + Intergenic
1179494085 21:41760739-41760761 CCCCAGGAGGAGCAGCTGGGGGG + Intronic
1179613869 21:42569392-42569414 CCTTCGGAGGAGCAGCAGGGAGG - Intronic
1180158038 21:45987493-45987515 CATTCGAAGGAGCAGCACTGTGG - Exonic
1180347146 22:11711884-11711906 TCTTCGGAGGAGGAGAGGGGCGG + Intergenic
1180354894 22:11829974-11829996 TCTTCGGAGGAGGAGAGGGGCGG + Intergenic
1180383357 22:12162357-12162379 TCTTCGGAGGAGGAGAGGGGCGG - Intergenic
1181004845 22:20008400-20008422 CCTTAGGAGGGGGAGCTGGGAGG - Intronic
1181425699 22:22836905-22836927 CCTTGGGAGGTTGAGCAGGGAGG - Intronic
1182258206 22:29053273-29053295 CCTTGGGAAAAGCAGCAGAGAGG - Intronic
1183832597 22:40426294-40426316 CCTTCAGAGGAAGAGGAGGGAGG - Intronic
1185078120 22:48694230-48694252 CCCTGGGAGGACCAGCAGGGCGG + Intronic
1185088292 22:48752500-48752522 CCTATGGAAGAGCAGCTGGGGGG - Intronic
1185105022 22:48863848-48863870 CAGTGGGAGGAACAGCAGGGAGG - Intergenic
950433677 3:12966443-12966465 CCTTCTGAGGAGCAGGGGGGTGG - Intronic
953268775 3:41419249-41419271 GTTTCTGAGGACCAGCAGGGAGG + Intronic
953450232 3:42999428-42999450 CCCTGGGAGAAACAGCAGGGAGG - Intronic
954088000 3:48261409-48261431 CCTTTGGAGGAAAAGCAAGGAGG + Intronic
954369467 3:50162637-50162659 CCTCCGTGGCAGCAGCAGGGAGG + Intronic
960620841 3:119635497-119635519 CCTTAGGAGGGGCAGCACAGTGG + Intergenic
962344756 3:134610928-134610950 CCTTGGGAGGAATAGCAGGGGGG - Intronic
962417361 3:135195296-135195318 CCCTAGGAAGAGCAGCAGTGTGG - Intronic
962927043 3:140004480-140004502 CATTCACAGGAGCAGCAGGGAGG + Intronic
962960758 3:140309352-140309374 CCTGGGGAGGATCAGCAGGTAGG - Intronic
963204459 3:142618267-142618289 ACTTGGGAGATGCAGCAGGGTGG - Intronic
966883392 3:184361998-184362020 TCTTCGGAGGGGCAGAGGGGAGG - Intronic
968353373 3:198080885-198080907 TCTTCGGAGGAGGAGCGGGGCGG - Intergenic
968511659 4:998296-998318 CCATGGGAGGACCAGAAGGGAGG + Intronic
968938332 4:3624973-3624995 ACTGGGGAGGAGCAGCTGGGAGG + Intergenic
969442027 4:7222853-7222875 TCTGCAGAGGAGCTGCAGGGAGG + Intronic
969524533 4:7697492-7697514 CCATGGGAAGAGCAGCTGGGTGG - Intronic
971422910 4:26490362-26490384 CCTGCCGTGGAGGAGCAGGGAGG + Exonic
972482949 4:39515080-39515102 CTTTAGGAGGAGGAGCAGGGAGG - Intronic
972758358 4:42075315-42075337 CTTTCGGAGGCCGAGCAGGGAGG - Intronic
974630475 4:64481284-64481306 ACTTCAGAGGAGGAGCAAGGTGG - Intergenic
975704262 4:77096415-77096437 CCCACAGAGAAGCAGCAGGGAGG + Intergenic
978166966 4:105621075-105621097 CCTTGGCAGGAACAGCTGGGAGG - Intronic
982350297 4:154407953-154407975 GGGTGGGAGGAGCAGCAGGGAGG - Intronic
983935628 4:173500960-173500982 CCTTCCGGGGAGCAGAAGGCCGG + Intergenic
984029932 4:174591075-174591097 CATTAGGAAGAGCTGCAGGGAGG - Intergenic
984710527 4:182880511-182880533 CTCTCGGAGGAGCAGCAGCAGGG - Intergenic
985046535 4:185946642-185946664 CATTTAGAGGAGAAGCAGGGTGG - Intronic
985362786 4:189193148-189193170 CTTTGGGAGGAGAAGGAGGGTGG - Intergenic
985508517 5:298819-298841 GCTGCGGGGGAGCAGCTGGGGGG - Intronic
985645940 5:1084818-1084840 CTTTTGGAGGAGCAGCTGGGAGG - Intronic
986313987 5:6573945-6573967 CCTTCAGAGGAGCAGCAAGGAGG - Intergenic
986374296 5:7114721-7114743 CCTTCAGAGGGGAGGCAGGGAGG - Intergenic
989121601 5:38009980-38010002 CCTCCTGAGGAGCAGCACGCTGG - Intergenic
999252451 5:150190679-150190701 CCTGGCGGGGAGCAGCAGGGTGG - Intronic
999386694 5:151158494-151158516 GCCTCCGAGGATCAGCAGGGGGG + Intergenic
1003493400 6:6642860-6642882 TCTCCGGAGGAGGAGGAGGGAGG - Intronic
1006627557 6:35408120-35408142 CCTTCGGAGCAGCAGAAGACAGG - Intronic
1006654098 6:35575659-35575681 CCCTCCGGGCAGCAGCAGGGGGG + Exonic
1007327361 6:41072845-41072867 CCTTCGGAGGAGCAACGCGCAGG - Intronic
1007335518 6:41152362-41152384 CCCTGGGAGGAGCGTCAGGGAGG - Intronic
1015171346 6:130257836-130257858 CCTTCAGAGTACCAGCAGGAAGG - Intronic
1016686196 6:146884857-146884879 CCTTCTGAGGAGGACTAGGGAGG + Intergenic
1016966590 6:149723616-149723638 CTTTCGGAGGTGGAGGAGGGTGG + Intergenic
1019304851 7:328480-328502 CCTTCCGGGTGGCAGCAGGGTGG - Intergenic
1019539937 7:1546947-1546969 CCCTCGGAGGACCTGTAGGGGGG - Exonic
1020594386 7:10186422-10186444 CCTTGGGAGGCCCAGCAGGGAGG + Intergenic
1021551923 7:21879839-21879861 CCTTGGGAGGCCGAGCAGGGTGG + Intronic
1022203285 7:28138662-28138684 CCTTTGGAGAAGAAGAAGGGTGG - Intronic
1022339637 7:29456192-29456214 CGTTCAGAGGAGCAGATGGGAGG - Intronic
1023069252 7:36412759-36412781 CCTGTGGAGGAGCAGTGGGGAGG - Intronic
1023462902 7:40420126-40420148 CCTTCGGAGTATCAGCAGCTGGG + Intronic
1023996048 7:45159426-45159448 GCTCAGGAGGACCAGCAGGGAGG + Intronic
1024996730 7:55278201-55278223 CATTTGGAGGAGCCCCAGGGAGG + Intergenic
1026284491 7:68951251-68951273 CGTGCGGAGGAGCAGCTAGGTGG - Intergenic
1026845502 7:73696896-73696918 CCATGGGAGAAGCAGCAAGGGGG - Intronic
1027304248 7:76876003-76876025 ACATTTGAGGAGCAGCAGGGTGG - Intergenic
1030149046 7:106384441-106384463 CCTTCAAAGGAGCAGCATGGGGG + Intergenic
1034349458 7:150406704-150406726 CCTTTGGAGAAGCAGCATGAAGG + Intronic
1035468656 7:159096118-159096140 CCTTAAGGGGAGCAGCAGGGAGG + Intronic
1036706931 8:11053135-11053157 ACTGCGCAGGAGCAGCAGGCTGG + Intronic
1040076978 8:43246690-43246712 CCTGCGGCGGAGGAGCGGGGCGG + Intergenic
1040592233 8:48804329-48804351 CCTTCAGAGGAGAGGGAGGGTGG + Intergenic
1040877928 8:52172289-52172311 TCATCAGAGGAGCAGAAGGGTGG + Exonic
1040969323 8:53116366-53116388 CCTTCAAAGGATCAGGAGGGAGG - Intergenic
1042052425 8:64725686-64725708 GGTTAGGAGGAGGAGCAGGGAGG + Intronic
1043949246 8:86289822-86289844 ACTTTGGAGGATCAGAAGGGTGG + Intronic
1045037043 8:98183965-98183987 CCTTCTGAGGCCCAGCAGGCCGG + Intergenic
1045108763 8:98919799-98919821 TCTTAGGAGCAGCAGCAGGTAGG + Intronic
1048794598 8:138138186-138138208 CCTGTGGAGGAGGAGGAGGGAGG - Intronic
1049124365 8:140773596-140773618 CGTGCTGAGGAGCAGCAGGGAGG + Intronic
1049849586 8:144823606-144823628 CCTGGGGAGGTGCAGCAGGCAGG + Intergenic
1050218713 9:3361236-3361258 CATCCAGAGTAGCAGCAGGGAGG + Intronic
1052996021 9:34552018-34552040 CCTGCAGAGGAGCAGGAGGCCGG - Exonic
1053503379 9:38620808-38620830 TCTTCGGAGGAGGAGCGGGTCGG - Intergenic
1053656585 9:40222914-40222936 CCTTCTGAGGAGGAGCGGGGCGG + Intergenic
1053752654 9:41273061-41273083 TCTTCGGAGGAGAAGAGGGGCGG - Intergenic
1053906939 9:42852136-42852158 CCTTCCGAGGAGGAGCGGGGTGG + Intergenic
1054258182 9:62837413-62837435 TCTTCGGAGGAGAAGAGGGGTGG - Intergenic
1054357004 9:64071361-64071383 CCTTCCGAGGAGGAGCGGGGCGG + Intergenic
1054368689 9:64369136-64369158 CCTTCCGAGGAGGAGCGGGGCGG + Intergenic
1054528030 9:66153371-66153393 CCTTCCGAGGAGGAGCGGGGCGG - Intergenic
1054676318 9:67858888-67858910 CCTTCTGAGGAGGAGCGGGGCGG + Intergenic
1055644346 9:78348767-78348789 CGTTCCGTGGAGCAGCTGGGTGG - Intergenic
1057152756 9:92809102-92809124 TCTTTGGAGGAGGAGCGGGGCGG + Intergenic
1057814664 9:98285701-98285723 CTTTCAGAGGAGCTGCAGGAAGG + Intergenic
1058586428 9:106511507-106511529 CCATTTGAGGAGCAGCAGTGAGG + Intergenic
1058596244 9:106618726-106618748 CAGTTGGAGGAGTAGCAGGGAGG - Intergenic
1058618837 9:106862703-106862725 CCTTCTGGGGTTCAGCAGGGGGG + Intergenic
1059887418 9:118761722-118761744 TCTTCTGAGGAGTATCAGGGAGG + Intergenic
1061390783 9:130316063-130316085 CCCTCGGTGGTGCAGCAGAGGGG - Intronic
1061418290 9:130459911-130459933 CCTTCCGAAGAGCAGCAGGCAGG - Intronic
1062174402 9:135153017-135153039 CAGTTGGAGGGGCAGCAGGGAGG - Intergenic
1062209491 9:135356039-135356061 CCTTGGCAGGAGCAGCGAGGGGG - Intergenic
1062523589 9:136969574-136969596 CCTTGGGAGGGGAAGCGGGGTGG - Intronic
1202800595 9_KI270719v1_random:170963-170985 TCTTCGGAGGAGAAGAGGGGCGG + Intergenic
1203696979 Un_GL000214v1:108661-108683 TCTTCGGAGGAGGAGAGGGGCGG - Intergenic
1203748543 Un_GL000218v1:58100-58122 CCTTCCGAGGAGGAGCGGGGCGG + Intergenic
1203561177 Un_KI270744v1:59920-59942 CCTTCCGAGGAGGAGCGGGGCGG - Intergenic
1188114145 X:26223240-26223262 ACTTCAGAGCAGCAGAAGGGAGG + Intergenic
1190739828 X:53281491-53281513 CCCCGGGAGGAGCAGCAGGTAGG - Intronic
1192564691 X:72153901-72153923 CTTTTGGAAGAGCAGCCGGGTGG - Intergenic
1196730749 X:118938940-118938962 CCTTCCCAGGGGCAGCCGGGAGG - Intergenic
1201153516 Y:11107941-11107963 TCTTCGGAGGAGAAGAGGGGCGG + Intergenic
1201161888 Y:11173070-11173092 CGTTCTGAGGAGGAGCGGGGCGG + Intergenic
1201584966 Y:15549948-15549970 GCATCTGAGGAACAGCAGGGAGG + Intergenic