ID: 1179623201

View in Genome Browser
Species Human (GRCh38)
Location 21:42632391-42632413
Sequence TGAGACATGGGGCAGCCACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179623201_1179623208 -8 Left 1179623201 21:42632391-42632413 CCCGGTGGCTGCCCCATGTCTCA No data
Right 1179623208 21:42632406-42632428 ATGTCTCAGGATTGGCCTCATGG No data
1179623201_1179623210 15 Left 1179623201 21:42632391-42632413 CCCGGTGGCTGCCCCATGTCTCA No data
Right 1179623210 21:42632429-42632451 AGCTTGCGCATGTGCTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179623201 Original CRISPR TGAGACATGGGGCAGCCACC GGG (reversed) Intergenic
No off target data available for this crispr