ID: 1179626546

View in Genome Browser
Species Human (GRCh38)
Location 21:42652695-42652717
Sequence CGGCTCCAGCAGGCCCGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179626533_1179626546 23 Left 1179626533 21:42652649-42652671 CCAGGGGAGGGAGAGGAAGTGAC No data
Right 1179626546 21:42652695-42652717 CGGCTCCAGCAGGCCCGAAGGGG No data
1179626541_1179626546 -7 Left 1179626541 21:42652679-42652701 CCTGGCACTGGCTGGCCGGCTCC No data
Right 1179626546 21:42652695-42652717 CGGCTCCAGCAGGCCCGAAGGGG No data
1179626540_1179626546 -6 Left 1179626540 21:42652678-42652700 CCCTGGCACTGGCTGGCCGGCTC No data
Right 1179626546 21:42652695-42652717 CGGCTCCAGCAGGCCCGAAGGGG No data
1179626537_1179626546 1 Left 1179626537 21:42652671-42652693 CCACTGGCCCTGGCACTGGCTGG No data
Right 1179626546 21:42652695-42652717 CGGCTCCAGCAGGCCCGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179626546 Original CRISPR CGGCTCCAGCAGGCCCGAAG GGG Intergenic
No off target data available for this crispr