ID: 1179627270

View in Genome Browser
Species Human (GRCh38)
Location 21:42655781-42655803
Sequence CAAACAGGGAGGCGCCAGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 146}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179627264_1179627270 -1 Left 1179627264 21:42655759-42655781 CCATAAACGTCCTTTTGTGGTGC 0: 1
1: 0
2: 0
3: 7
4: 60
Right 1179627270 21:42655781-42655803 CAAACAGGGAGGCGCCAGACGGG 0: 1
1: 0
2: 0
3: 9
4: 146
1179627262_1179627270 3 Left 1179627262 21:42655755-42655777 CCTTCCATAAACGTCCTTTTGTG 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1179627270 21:42655781-42655803 CAAACAGGGAGGCGCCAGACGGG 0: 1
1: 0
2: 0
3: 9
4: 146
1179627260_1179627270 12 Left 1179627260 21:42655746-42655768 CCCTCAGTTCCTTCCATAAACGT 0: 1
1: 0
2: 0
3: 16
4: 154
Right 1179627270 21:42655781-42655803 CAAACAGGGAGGCGCCAGACGGG 0: 1
1: 0
2: 0
3: 9
4: 146
1179627261_1179627270 11 Left 1179627261 21:42655747-42655769 CCTCAGTTCCTTCCATAAACGTC 0: 1
1: 0
2: 0
3: 7
4: 143
Right 1179627270 21:42655781-42655803 CAAACAGGGAGGCGCCAGACGGG 0: 1
1: 0
2: 0
3: 9
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179627270 Original CRISPR CAAACAGGGAGGCGCCAGAC GGG Intronic
900652383 1:3736243-3736265 CAAACAGGGCGGCTCCTCACAGG + Intergenic
903810404 1:26032013-26032035 CACACAGGAAGGCTCCAAACAGG + Intronic
904976522 1:34461057-34461079 CAAGCAGGGTGGGGCTAGACGGG - Intergenic
907459379 1:54596263-54596285 CAGACAGGGTGGGGGCAGACAGG - Intronic
907710443 1:56875881-56875903 CAAGCTGGGAGGCTGCAGACAGG + Intronic
910849414 1:91636039-91636061 GAAACAGGGAGGCGCAGGTCTGG + Intergenic
910865923 1:91788031-91788053 CCAAGAGGGAGGTGCCAGAAAGG + Intronic
1068256223 10:54515397-54515419 CAAACTGTAAGGCGGCAGACAGG + Intronic
1069685792 10:70317673-70317695 CAGAGAGGGAGACGCCTGACTGG - Intronic
1069786778 10:70993312-70993334 CAAATAGGCAGGCTGCAGACCGG + Intergenic
1071371449 10:84955681-84955703 GTAACAGAGAGGCCCCAGACAGG + Intergenic
1071838577 10:89445016-89445038 CAAACTGTGAGGCGGCAGCCCGG + Intronic
1072942990 10:99784184-99784206 CAAACATGCAGGCGCCATGCAGG - Intronic
1083769243 11:64857096-64857118 CTCACAGGGAGGCTCCAGAAGGG + Intronic
1083801112 11:65046864-65046886 CAAACAGGGAGGTGCCAGCTGGG + Intronic
1083959620 11:66007347-66007369 CCCACAGGGAGGGGCCAGCCTGG - Intergenic
1087654030 11:100901639-100901661 CAAACAGTGAGGTGGCAGCCTGG - Intronic
1087780936 11:102301087-102301109 CAAACAGTGAGGTGGCAGCCTGG - Intergenic
1091704369 12:2683899-2683921 CAGACAGGGAGGAGCCCCACGGG + Intronic
1094341085 12:29412029-29412051 CAAACAGCAAGGCGGCAGAGAGG - Intergenic
1094877968 12:34672673-34672695 CAAACAGCAAGGCGGCAGCCAGG - Intergenic
1095951047 12:47782142-47782164 CAGAGAGGAAGGCGCCAGGCTGG - Exonic
1102026632 12:109717499-109717521 CAAATAGGAATGTGCCAGACAGG + Intronic
1105201376 13:18182556-18182578 CGAACTGGGAGGCAGCAGACAGG + Intergenic
1105519366 13:21117722-21117744 GAAACTGGGAGGCACCAGCCTGG - Intergenic
1106602992 13:31203065-31203087 CACACAGGGAAGTGACAGACAGG - Intronic
1107732658 13:43364442-43364464 AACACAGAGAGGAGCCAGACAGG - Intronic
1109358586 13:61267058-61267080 CAAACAGTGAGGTGGCAGCCTGG + Intergenic
1113942252 13:114024475-114024497 CAACCAGGAAGGCGCCAGGCGGG + Intronic
1119181471 14:72608144-72608166 CAAGGAGGCAGGCACCAGACAGG - Intergenic
1119520081 14:75278735-75278757 CAACCACGGTGGCGCCAGAGGGG - Intergenic
1131204926 15:90436039-90436061 CAAGCAGGGAGGAGACAGAGAGG - Intronic
1133430711 16:5734644-5734666 CAAAGAGGAAGGCGACAGGCAGG - Intergenic
1135865022 16:26093007-26093029 CAAACTGTGAGGCGGCAGCCTGG + Intronic
1137510189 16:49092823-49092845 CACACAGGGAGGCACCAGGGTGG + Intergenic
1138552464 16:57755071-57755093 CAGAGAGGGAGGCCCCAGGCCGG + Intronic
1140224287 16:73066148-73066170 TAAACAGGGAGGCGGCTGAGAGG - Intergenic
1141667329 16:85472644-85472666 CCAACAGGGGGAGGCCAGACCGG - Intergenic
1142202932 16:88769777-88769799 GAAACAGGGAGGGGCCAGGGTGG + Intronic
1143635407 17:8161658-8161680 CAAACTGGGAGGCCCCCGCCTGG + Exonic
1144810385 17:17995016-17995038 CAAACAGGAAGGAGCCATTCAGG - Exonic
1146525468 17:33563687-33563709 GAACCAGTGAGGGGCCAGACTGG + Intronic
1146686423 17:34844443-34844465 CACAGAGGCAGGCCCCAGACAGG - Intergenic
1148215082 17:45829940-45829962 CACACAGGGAGGTGACAGCCAGG - Intronic
1149954895 17:61037691-61037713 GAACCAGGGAGGCGGCAGCCTGG + Intronic
1151317254 17:73330676-73330698 CAATTAGGGAGGAGCCAGTCTGG + Intergenic
1151678200 17:75610617-75610639 CAGCCAGGGAGGGGCCAGAGAGG - Intergenic
1152392568 17:80011420-80011442 CAGACAGGGAGGCTGCAGGCAGG - Intronic
1152771030 17:82169470-82169492 AAGAAAGGGAGGGGCCAGACAGG - Intronic
1155576189 18:27249667-27249689 CAAATAGGGAGATGCAAGACTGG - Intergenic
1156196150 18:34776302-34776324 CAAACACGGAGAAGCCACACAGG + Intronic
1156378766 18:36538105-36538127 CAAACAGGAAGTCTCCAGAGGGG + Intronic
1157146374 18:45166894-45166916 CAAAGAGGGCGGCACCAGCCTGG + Intergenic
1160462064 18:79046784-79046806 GACCCAGGGAGGGGCCAGACGGG + Intergenic
1162927873 19:13939071-13939093 CCAACAGGGCGGCTTCAGACAGG + Intronic
1162934705 19:13976077-13976099 CAAGCTGGCAGGGGCCAGACAGG - Intronic
1167369740 19:49073326-49073348 CAAACAGGGCGACTCCAGGCCGG - Intergenic
1167735991 19:51294824-51294846 CACACAGGGATACGCCAGGCGGG + Intergenic
1168162598 19:54521609-54521631 CAAACAGGAAGGACGCAGACGGG + Intergenic
1168164192 19:54535471-54535493 CAAACAGGAAGGACGCAGACGGG + Intronic
1168287191 19:55340719-55340741 GACTCAGGGAGGAGCCAGACGGG - Intronic
925140561 2:1547230-1547252 CACACAGGGTGGCCCCACACAGG + Intergenic
925361465 2:3283336-3283358 CAAACATGGAGGCACCCGAGGGG + Intronic
925893874 2:8456916-8456938 CAGACAGCGCGGCCCCAGACCGG - Intergenic
928309298 2:30196286-30196308 CAAACAGGGCTGCACCATACTGG + Intergenic
928413568 2:31072749-31072771 CAAGCAGAGATGTGCCAGACAGG + Intronic
930803058 2:55462553-55462575 CAAACTGTGAGGCGGCAGCCTGG + Intergenic
932263601 2:70346969-70346991 CAACCAGGGAGGCCCCAGCATGG + Intergenic
933833327 2:86227462-86227484 CAAACAGGGAGGCCCTGGAGAGG + Intronic
936339466 2:111618368-111618390 CAAGAAGTGAGGCCCCAGACAGG + Intergenic
938580072 2:132637833-132637855 CTAACAGGGAGGTGGCAGAGAGG - Intronic
940176853 2:150887202-150887224 CAAACAGGGAAGCAACAGAGAGG + Intergenic
940720751 2:157279543-157279565 CAAACTGGGAGGCGGCAGCCTGG - Intronic
942668898 2:178352505-178352527 CGAACTGCGAGGCGGCAGACTGG + Intronic
948923908 2:241081890-241081912 CAAACGATGAGGTGCCAGACAGG + Intronic
1173810307 20:45951331-45951353 CAAACAGGGAGGCCCCAAGCTGG + Intronic
1174044560 20:47724347-47724369 AAAACAGGCAGGCGGAAGACAGG - Intronic
1175210363 20:57350455-57350477 CAAACAGGGAGAGGCCAGGGCGG + Intergenic
1176086482 20:63297610-63297632 CACCCAGGGAGGCCCCAGCCTGG - Intronic
1176184696 20:63771824-63771846 GAAACAGGCAGGGGCCACACAGG + Intronic
1176716574 21:10355432-10355454 CGAACTGGGAGGCAGCAGACAGG - Intergenic
1179627270 21:42655781-42655803 CAAACAGGGAGGCGCCAGACGGG + Intronic
1180640992 22:17299362-17299384 CAAACTGGGAGGCGGCAGCCTGG - Intergenic
1182679381 22:32066931-32066953 CAAAGAGGGAGGCTCCAATCTGG - Exonic
1183357434 22:37367204-37367226 CTAGCAGGTAGGCCCCAGACTGG + Intergenic
1183628665 22:39020419-39020441 CGCGCAGGGAGGCTCCAGACAGG + Intronic
1183632143 22:39040178-39040200 CGCGCAGGGAGGCTCCAGACAGG + Intergenic
1183637963 22:39076579-39076601 CGCGCAGGGAGGCTCCAGACAGG + Intronic
1184095691 22:42315109-42315131 CAAGCAGGGAGGGGGCAGACAGG + Intronic
1184615239 22:45633479-45633501 CAAACAGGATGGAGCCACACTGG + Intergenic
1184768786 22:46586311-46586333 AAAGCAGGGAGGCGCCAGTGGGG - Intronic
949860870 3:8503576-8503598 CAAACAGGGATGAACAAGACAGG - Intronic
950086482 3:10261896-10261918 CACACAGGGAGGCTGCAGAAAGG - Intronic
950542691 3:13621649-13621671 CAGGCGGGGAGGCCCCAGACAGG + Intronic
951384093 3:22024113-22024135 AAAACATGAAGGAGCCAGACGGG + Intronic
954871974 3:53774264-53774286 CACACAGGGAAGCGTGAGACAGG - Intronic
957237068 3:77607508-77607530 AAAACATGAAGGCACCAGACGGG + Intronic
965009012 3:163062622-163062644 AAAAAAGGGAGGAGCAAGACAGG + Intergenic
968081557 3:195849872-195849894 CAGACAGGGAGGCCCCACCCCGG + Intergenic
968563702 4:1298193-1298215 CAAGCAGGCAGGCGACAGACAGG - Intronic
968742655 4:2339333-2339355 CACAGAGGGAGGAGCCAGGCAGG - Intronic
972635671 4:40882082-40882104 CAACCAGGGAGGGGACAGGCAGG + Intronic
976783282 4:88786143-88786165 GAAACAGATAGGGGCCAGACAGG - Intronic
977002406 4:91519761-91519783 AAGACAGGGAGGAGCAAGACAGG - Intronic
980943906 4:139301232-139301254 CTAGCAGGAAGGCGCCAGAGAGG + Intronic
981427686 4:144622412-144622434 CAGGCAGGGTGGCGCCAGCCAGG + Intergenic
987760697 5:22159526-22159548 CAAACAGAGAGCTGCCAGAGAGG - Intronic
993242973 5:85414867-85414889 CAAACAGGGAGCCCCCAGCTTGG - Intergenic
997595920 5:135107467-135107489 CAAACAAGGTTGCGCCAGCCAGG - Intronic
998106355 5:139471609-139471631 CAAGCAGGGTGGAGTCAGACAGG + Intergenic
1006644777 6:35508698-35508720 GAAACAGGGAGGCTCCTGATGGG + Intronic
1007384338 6:41510495-41510517 CAGACAGGGAAGAGCCAGCCTGG - Intergenic
1007850035 6:44793936-44793958 CAAACTGGCAGGAGCCAGAGTGG - Intergenic
1010171817 6:72984436-72984458 CAAACTGTGAGGCGGCAGCCTGG - Intronic
1013197707 6:107860318-107860340 CAAACAGCAAGGCGGCAGCCAGG - Intergenic
1013860849 6:114633706-114633728 CAAACTGTGAGGCGGCAGCCTGG - Intergenic
1014213839 6:118734415-118734437 CAAACATGGAGGAGCCAGATTGG - Intergenic
1015464456 6:133533249-133533271 CAAACACGGAGGTGCCAGTTTGG - Intergenic
1019073009 6:169365447-169365469 CAAACTCAGAGGCGCCAGAAAGG + Intergenic
1020683019 7:11259923-11259945 CAGCCAAGGAGGGGCCAGACTGG - Intergenic
1021594096 7:22296337-22296359 CACACAAGGAGGAGCCACACAGG + Intronic
1022459492 7:30591677-30591699 CAAACAGGCAAGCCACAGACTGG + Intergenic
1023700667 7:42888951-42888973 CGAACAGGGCGGCGCCTGCCTGG - Intergenic
1027154393 7:75756295-75756317 CAAGCTGGGAGGCACCAGGCTGG - Intergenic
1028114489 7:86982077-86982099 CAAACTGCGAGGCGGCAGCCTGG + Intronic
1028525881 7:91786157-91786179 CAAACAAGGAGCCACCAGGCTGG - Intronic
1029004265 7:97191115-97191137 CAAACAGGGAGCCTACAGAATGG + Intergenic
1029274242 7:99394617-99394639 CAAAAAGGGAGGGGACAGATGGG + Exonic
1030177739 7:106672150-106672172 CAAACTGCGAGGCGGCAGCCTGG + Intergenic
1030358664 7:108570558-108570580 CTGACAGGGAGGCGCCTCACTGG - Intronic
1032434666 7:131890128-131890150 CATCCAGGGAGGCCACAGACAGG - Intergenic
1035130661 7:156650267-156650289 CAACAAGGGAGGAGCCAGAAAGG + Intronic
1041451259 8:58008929-58008951 GAAATAGAGAGGAGCCAGACAGG - Intronic
1044209641 8:89535637-89535659 CAAACTGCGAGGCGGCAGCCAGG + Intergenic
1044336081 8:90985570-90985592 AAGACTGGGAGGCGCCAGGCGGG + Intergenic
1046927676 8:119809683-119809705 CAAACAGGGAGGCCCGAGGAAGG + Intronic
1048951851 8:139502852-139502874 AAAACAGTGAGGGGTCAGACTGG + Intergenic
1050376205 9:4975998-4976020 CAAACAGGAAGGCACTCGACTGG - Intergenic
1050645313 9:7713318-7713340 CAAACTGCGAGGCGACAGCCTGG + Intergenic
1052915837 9:33923794-33923816 CAAACATGGTGGGGCCATACTGG + Exonic
1060596289 9:124851087-124851109 CAGGCAGGCAGGGGCCAGACAGG + Intergenic
1060828199 9:126698357-126698379 CAAACAGGGAGAGGCCAGCCCGG - Exonic
1060831643 9:126721394-126721416 AAAAAAGGGGGGCGACAGACTGG + Intergenic
1061295742 9:129675774-129675796 CAAAGCGGGAGCCGCCAGGCGGG + Intronic
1061552388 9:131345116-131345138 CAAACCGTGAGGCGGCAGCCAGG - Intergenic
1061783610 9:133009956-133009978 CCAACAGGCAGGGGCCACACAGG - Intergenic
1062190730 9:135246658-135246680 CAAACGGGGAGGCCCAAGAGTGG + Intergenic
1203776290 EBV:75046-75068 CAAACAGGCTGGCGACAGCCTGG + Intergenic
1187688466 X:21839882-21839904 CAGCCCGGGAGGCGCCAGGCAGG - Intronic
1190976480 X:55407265-55407287 CATACAAGGAGGCATCAGACTGG + Intergenic
1191871568 X:65750782-65750804 GAACCAGGGAGGAGCCAGGCTGG + Intergenic
1195319102 X:103706915-103706937 AAAACAGGGAGGCTCCAGCAAGG + Intergenic
1197280785 X:124533476-124533498 GAAACAGGGAGGCACCATAATGG - Intronic
1197438376 X:126460351-126460373 CAAACAGCAAGGCGGCAGCCAGG + Intergenic
1198643211 X:138778710-138778732 CAAACAGCAAGGCGGCAGCCAGG + Intronic
1199034516 X:143033994-143034016 AAAACAGGGAGAGGCCAGAATGG - Intronic