ID: 1179627413

View in Genome Browser
Species Human (GRCh38)
Location 21:42656485-42656507
Sequence AGGCCCCGGGCAGCAAGTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 229}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179627407_1179627413 7 Left 1179627407 21:42656455-42656477 CCAGGTTGACAATCTGAAGTTGT 0: 1
1: 0
2: 0
3: 13
4: 168
Right 1179627413 21:42656485-42656507 AGGCCCCGGGCAGCAAGTGCCGG 0: 1
1: 0
2: 1
3: 26
4: 229
1179627406_1179627413 18 Left 1179627406 21:42656444-42656466 CCGGCAAAGCTCCAGGTTGACAA 0: 1
1: 0
2: 0
3: 15
4: 140
Right 1179627413 21:42656485-42656507 AGGCCCCGGGCAGCAAGTGCCGG 0: 1
1: 0
2: 1
3: 26
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179627413 Original CRISPR AGGCCCCGGGCAGCAAGTGC CGG Intronic
900324330 1:2100621-2100643 GGGCCTCGGGGAGCAGGTGCAGG + Intronic
900477099 1:2881150-2881172 AGGCTCCGGCCAGCGTGTGCGGG + Intergenic
900682383 1:3924143-3924165 AGGCCCGGGGCCTCAAGTGCGGG - Intergenic
900730473 1:4255646-4255668 ATGGCCCTGGTAGCAAGTGCTGG - Intergenic
901201261 1:7468722-7468744 AGGCCTCAGGCAGCAACTCCTGG - Intronic
901233190 1:7652509-7652531 AGGCCCCAGCCAGCAAGGCCTGG + Intronic
901836287 1:11926078-11926100 GGGACCAGGGCAGCAGGTGCAGG + Exonic
903652599 1:24930649-24930671 AGGCCCGAAGCAGCAAGAGCTGG - Intronic
904303928 1:29574808-29574830 AGGCCCTGGGCCCCCAGTGCAGG - Intergenic
904354608 1:29930900-29930922 AGGCCCTGGGCAGGCAGAGCAGG + Intergenic
905166339 1:36085297-36085319 AGCCCCCGGGCACCCAGTCCTGG - Intronic
905262377 1:36729016-36729038 AGGGCCAGGACAGCAAGGGCGGG + Intergenic
905664306 1:39753285-39753307 AGGCCCAGGGCAGCAAGGACGGG + Intronic
906657700 1:47560771-47560793 AGGCTCCAGGCAGCCAGAGCTGG - Intergenic
906706079 1:47895986-47896008 ATGCCCCCGGCAGCCATTGCTGG - Intronic
907430572 1:54408925-54408947 AGGGCCCGGGCAGAGAGAGCAGG + Intronic
911292184 1:96070950-96070972 AGGCCCCTGGCAGAGAGTTCAGG + Intergenic
913592211 1:120341004-120341026 CCGCCCCCGGCAGCAAGTGCCGG + Intergenic
913651147 1:120914142-120914164 CCGCCCCCGGCAGCAAGTGCCGG - Intergenic
914169964 1:145214925-145214947 CCGCCCCCGGCAGCAAGTGCCGG + Intergenic
914525081 1:148458888-148458910 CCGCCCCCGGCAGCAAGTGCCGG + Intergenic
914598595 1:149176942-149176964 CCGCCCCCGGCAGCAAGTGCCGG - Intergenic
914641322 1:149608246-149608268 CCGCCCCCGGCAGCAAGTGCCGG - Intergenic
915623223 1:157098753-157098775 GGGCCCCCAGCAGCAAGTGGGGG + Exonic
915731697 1:158058610-158058632 AGGTCTCGGGGAGCTAGTGCAGG + Intronic
919674297 1:200366337-200366359 GGGCCCAGGGCAGCATGTGCTGG + Intergenic
920400009 1:205670550-205670572 AGGCACCAGGGAGCAAGTCCGGG - Intronic
923626567 1:235618560-235618582 AGCCCCTGGGCTGCAACTGCAGG - Intronic
924763175 1:247007813-247007835 AGGCCCGGGGCCGCCAGCGCTGG + Intronic
1063974068 10:11401510-11401532 AGGCCCCGGGGAGCCAGGGAGGG - Intergenic
1064336769 10:14450485-14450507 AGGCCTCGGGCAGCATCTCCTGG - Intronic
1067294656 10:44968389-44968411 AGGCCCCCAGCAGCAAGGCCTGG - Intronic
1070131117 10:73656018-73656040 AGGCCTGGGGCAGCAGGAGCAGG - Exonic
1070630753 10:78082702-78082724 AAGCCCTGGGAAGCAAGTCCTGG - Intergenic
1072543174 10:96413756-96413778 AGGGGCTGGTCAGCAAGTGCAGG + Intronic
1073933049 10:108598843-108598865 AGCCCACAGGCAGCAAGAGCAGG + Intergenic
1074801667 10:117005930-117005952 AGCCCCCGGGCAGCAGAGGCTGG + Intronic
1075657918 10:124174160-124174182 GGGCCCAGGGCAACACGTGCAGG + Intergenic
1076872001 10:133198918-133198940 AGGCCCCCGGAAGCAACTCCAGG - Exonic
1077483057 11:2825489-2825511 GGGCCCCTGGCAGCAAGGGCTGG - Intronic
1077550862 11:3199678-3199700 AGGCCCCAGGCAGCAAGGCAGGG - Intergenic
1078421476 11:11216451-11216473 AAGACCCAGGCAGCAAGGGCTGG + Intergenic
1078433634 11:11306940-11306962 AGGCACAGGGCAGCAAGAGAAGG - Intronic
1079442930 11:20533742-20533764 AGGCCTGGGGCAGGAAGTGAAGG - Intergenic
1079876315 11:25861577-25861599 AGGCTCTGGGCATCAAATGCAGG + Intergenic
1080660684 11:34293556-34293578 ATGCCCCAGGCGCCAAGTGCAGG + Intronic
1081484245 11:43515712-43515734 GGGCCCCGGGCAGGACGTGAAGG - Intergenic
1083721916 11:64607582-64607604 GGGCCCCGGGCCCCAAGGGCGGG + Exonic
1083777982 11:64903489-64903511 AGGACCCGGCCAGCAGCTGCGGG + Intronic
1083879245 11:65540049-65540071 AGGGCCCGGGCACCCAGGGCGGG + Exonic
1085277061 11:75307084-75307106 AGGCCCTCTGCAGCAAGTGAGGG - Intronic
1087778179 11:102275707-102275729 AGGTCCCAGCCAGCAAGTACTGG - Intergenic
1094048591 12:26195419-26195441 GGGCCCCGGGCAGGATTTGCAGG - Intronic
1097483977 12:60170193-60170215 ATGCCCAGGGACGCAAGTGCTGG - Intergenic
1097848691 12:64390692-64390714 GGGACCCGGGCCGCAACTGCAGG + Exonic
1102058654 12:109915596-109915618 AGGCCCAGGGGAGCAGGGGCCGG - Intronic
1102948492 12:117011233-117011255 CGGCCCCGGGCTGCAGGTGGCGG + Intronic
1102950417 12:117027327-117027349 AGGCCTGCGGCAGCAAGTGCAGG + Intronic
1103415694 12:120740417-120740439 CGGCCCTGGCCAGCCAGTGCGGG + Intergenic
1103969891 12:124663948-124663970 GGGCCCGGGGCCGCAAGTGGAGG + Intergenic
1106720494 13:32430155-32430177 AGGTCCCAGGCAGCAGCTGCAGG + Intergenic
1108520707 13:51244664-51244686 AGGCACCGGGCAAGCAGTGCAGG + Intronic
1113370620 13:109722037-109722059 AGTCCCGCGGCAGTAAGTGCTGG - Intergenic
1114295177 14:21322542-21322564 AAGCCCCTGGAAGCAATTGCTGG - Intronic
1117131956 14:52695681-52695703 AGGCCCCGGGCTGCCGGCGCGGG - Exonic
1117272029 14:54154499-54154521 AGGCTCCGGGGTGCATGTGCAGG + Intergenic
1118839933 14:69502447-69502469 AGGCATAGGGGAGCAAGTGCTGG - Intronic
1119737981 14:76996017-76996039 ATGTGCCAGGCAGCAAGTGCAGG - Intergenic
1120119592 14:80663134-80663156 AGGCCCCGGGCTGAGAGAGCAGG + Intronic
1122115707 14:99526308-99526330 AGGCCCCGTGCAGCTCCTGCAGG + Intronic
1122302314 14:100738289-100738311 AGGCCCCGGGCAGGGTGGGCAGG + Intergenic
1122415677 14:101548510-101548532 AGGCCCTGGGGAGCACGGGCTGG + Intergenic
1122421336 14:101579389-101579411 AGGCTCTGAGTAGCAAGTGCAGG + Intergenic
1122826178 14:104371780-104371802 AGGCCCCGGGCAGTCAGTCCTGG - Intergenic
1123709913 15:22980031-22980053 AGGGACCGGGAAGCCAGTGCAGG + Intronic
1124023856 15:25946548-25946570 AGGCTCAGGACAGGAAGTGCCGG + Intergenic
1124358758 15:29018847-29018869 AGGTCACTGGCAGCAAGTGGGGG - Intronic
1125274953 15:37979717-37979739 AGCCTCAGGGCAGCAAGGGCAGG + Intergenic
1125743614 15:41984389-41984411 GGGCCAAGGGCAGCAGGTGCTGG + Intronic
1126786507 15:52181157-52181179 AGGCCCGGGACAGCAAGTGGAGG - Intronic
1128218914 15:65953963-65953985 AGACCCCGGGCAGGGAGAGCTGG + Intronic
1130903799 15:88226202-88226224 AAGCCCAGGGCAGCACCTGCCGG + Intronic
1131118564 15:89809144-89809166 AGGAGCCTGGCAGCATGTGCTGG - Intronic
1131666780 15:94579448-94579470 AGGCCCTTGGCAGCCAGTGAAGG + Intergenic
1132606321 16:795272-795294 AGGCCACGGGCAGGAAGGGTGGG - Exonic
1132634008 16:934024-934046 AGGCCCCGGGCACCTAGAGACGG - Intronic
1132680792 16:1140955-1140977 AGGTCCCGGCCAGCACGTCCTGG + Intergenic
1132864399 16:2086397-2086419 AGGCCTGGGGCAGCAGGAGCGGG - Intronic
1134531923 16:14990001-14990023 AGGACCAGGGAAGCAGGTGCAGG + Intronic
1135106613 16:19655318-19655340 AAGCCACAGGCAGCAATTGCTGG + Intronic
1136027093 16:27475502-27475524 AGGCCCTGGGCAGCACTGGCAGG + Intronic
1136776051 16:32872489-32872511 AGGCCTAGGGCAGCAGGTGATGG - Intergenic
1136894564 16:33989023-33989045 AGGCCTAGGGCAGCAGGTGATGG + Intergenic
1137057870 16:35754026-35754048 AGGCCCCGGGCCGCAATGGGAGG - Intergenic
1138891550 16:61149831-61149853 AGCCCGGGGGCAGCAAGGGCAGG + Intergenic
1139317440 16:66085887-66085909 AGGCCTCTGGCAGCTTGTGCAGG + Intergenic
1140318545 16:73923821-73923843 AGGCTCCAGGCAGTATGTGCTGG + Intergenic
1141705307 16:85661497-85661519 CGGGCCCGGGCAGGAAGGGCTGG - Exonic
1142113260 16:88343184-88343206 AGGTCCAGGAGAGCAAGTGCAGG - Intergenic
1142227359 16:88884181-88884203 AGGGCCCAGGCAGCAGGTGACGG - Intronic
1142309020 16:89301445-89301467 AGGCCCCGGGCAGACAGGGCAGG + Intronic
1203078467 16_KI270728v1_random:1134598-1134620 AGGCCTAGGGCAGCAGGTGATGG - Intergenic
1143099772 17:4498765-4498787 ACCCCCAGGGCAGCACGTGCGGG + Intergenic
1143491750 17:7289266-7289288 TGGCTCCAGGCAGCAAGTGGGGG + Intronic
1148467290 17:47872726-47872748 AGCCCCCCGGCGGCAAGGGCAGG + Intergenic
1148496258 17:48054983-48055005 AGCCCCAGGGCAGCCGGTGCCGG - Intronic
1150227928 17:63533838-63533860 AGGCACGGGGCAGCCACTGCTGG - Intronic
1151678749 17:75613335-75613357 AGGCCCCCAGCAGCTTGTGCTGG - Intergenic
1152081901 17:78192764-78192786 AGGCCCCGAGGAGGAAGTGTAGG + Intronic
1152576418 17:81143255-81143277 AGGTCCCAGGCAGCCTGTGCGGG + Intronic
1153155454 18:2144435-2144457 AGGCCCAAGGCAGCCAGTGGAGG - Intergenic
1154216764 18:12421172-12421194 AGGCTGGGGGCAGCAGGTGCAGG - Intronic
1158936986 18:62373678-62373700 GAGCCCAGGGCAGCCAGTGCCGG - Intronic
1160975617 19:1790870-1790892 GGCCCCCAGGCAGCCAGTGCGGG - Intronic
1161044280 19:2126798-2126820 AGGCCCTGAGCAGCAGGGGCCGG + Intronic
1161170899 19:2812048-2812070 AGGCCTCGGGCTGTGAGTGCTGG + Intronic
1163424926 19:17236024-17236046 CGGCACCAGGCAGCGAGTGCGGG + Exonic
1163490818 19:17616358-17616380 AGGCACCGGGCACCAGGCGCGGG + Intronic
1164578022 19:29417497-29417519 AGCCCCCAGGCTGCAGGTGCTGG + Intergenic
1164684142 19:30156093-30156115 AGGCCCCAGGGAGCCAGTGCAGG + Intergenic
1167309590 19:48729279-48729301 AGGCCCCGAGCCCCCAGTGCGGG + Exonic
1168078086 19:53991518-53991540 AGGCGCCGGGCGACAGGTGCGGG + Intergenic
925878102 2:8328865-8328887 AGGCCGAGGGCAGCAGGGGCTGG + Intergenic
927003915 2:18827757-18827779 AGTCAGCAGGCAGCAAGTGCTGG - Intergenic
927200381 2:20574703-20574725 AGCACCCGGGCAGGCAGTGCTGG + Intronic
927263956 2:21123912-21123934 GGGCCCCAGGGAGCATGTGCGGG - Exonic
927853350 2:26513438-26513460 AGGCCCCGGGCAGCCCAGGCTGG - Intronic
927997639 2:27497085-27497107 ATGCCCAGAGCACCAAGTGCAGG + Intronic
932285188 2:70525650-70525672 AAGGCCTGGGCAACAAGTGCAGG + Intronic
934664221 2:96158616-96158638 AGGCTCCATGCAGCAGGTGCTGG + Intergenic
934771878 2:96912503-96912525 AAGCCCAGGGAAGGAAGTGCTGG + Intronic
935218179 2:100990801-100990823 AGGACCCGGGCATCATGGGCTGG - Exonic
935256093 2:101310895-101310917 TGGCCCCTGGCAGCCAGTGTAGG - Intergenic
937956267 2:127423238-127423260 AGGGCGCGGGCAGCTGGTGCTGG - Intronic
938461798 2:131502137-131502159 AGGCCCCTTCCTGCAAGTGCTGG + Intergenic
942151171 2:173076676-173076698 AAGCCCGGGGCAGGAAGGGCGGG - Intronic
943811639 2:192195262-192195284 TGACCCCGGGCCGCGAGTGCGGG + Exonic
945312794 2:208334397-208334419 AGGTCCTGGGCAGCCAGTGCAGG - Intronic
948581327 2:238988955-238988977 AGGACTCTGGCAGCAAGTGCTGG + Intergenic
948648649 2:239424994-239425016 AACCCCAGGGCAGCAAGGGCTGG + Intergenic
948749322 2:240121788-240121810 GGGCCCCGTGCAGGAAGCGCAGG - Intergenic
948787766 2:240361880-240361902 AGGCCCAGTGGAGCAGGTGCCGG + Intergenic
948801657 2:240435986-240436008 GGGACCCGGCCAGCAAGAGCCGG + Exonic
1172039138 20:32031446-32031468 TGGCCCCGGGCCCCAAGGGCAGG - Exonic
1172107450 20:32525145-32525167 TGGCCCAGGGATGCAAGTGCTGG + Intronic
1172523523 20:35583973-35583995 AGGGCTCGGGCAGCAAATCCGGG + Intergenic
1173985343 20:47257160-47257182 AGGCCCCAGACAGCAAATGAGGG + Intronic
1174507644 20:51026981-51027003 AGGCCCCTGGAAGCAAGAGTTGG + Intergenic
1176026060 20:62986233-62986255 AGGGGCCGGGGAGCAAGAGCAGG + Intergenic
1178687593 21:34723552-34723574 AGGCCCAGGGCAGCCTGTGCAGG + Intergenic
1179024361 21:37667651-37667673 AGGCGCCGGGTAGCAGGTCCGGG + Intronic
1179627413 21:42656485-42656507 AGGCCCCGGGCAGCAAGTGCCGG + Intronic
1179807282 21:43847704-43847726 AGGACGCGGGCGGCAAATGCAGG - Intergenic
1179962321 21:44775180-44775202 AGGCCCAGCGCAGGAAGTGACGG - Intronic
1180064664 21:45406152-45406174 AGGCCCCGGTTAGCAGGTGGTGG - Intronic
1180181189 21:46119347-46119369 ATGCCCTGGGCAGCTGGTGCTGG - Intronic
1180230954 21:46426558-46426580 AGGCCCTGGGGGACAAGTGCTGG - Intronic
1180967484 22:19798154-19798176 CGGCCCCGCGCAGCAGGTGCTGG - Intronic
1180967489 22:19798183-19798205 CGGCCCTGCGCAGCAGGTGCTGG - Intronic
1181988188 22:26816419-26816441 AGGCCCCTGGCAGCTCATGCTGG - Intergenic
1183381086 22:37490939-37490961 AGGCCCAGAGCAGCAAGTAGAGG + Exonic
1183426873 22:37744778-37744800 AGACTCCTGGCAGCAAATGCTGG + Intronic
1183695960 22:39422322-39422344 AGGCCCTTGGCAGGAAGTGATGG - Intronic
1184288221 22:43483903-43483925 TGGCCACGGGCAGCAGGAGCTGG - Intronic
1184376397 22:44116574-44116596 TGGCGCCAGGCAGCAAGTGCTGG + Intronic
1184554734 22:45227043-45227065 AGGGCCCGGGCAGGGAGTGGAGG - Intronic
1184685618 22:46095384-46095406 AAGCCCAGGGCAGCAGGTGAGGG + Intronic
1184948161 22:47818805-47818827 AGGCTAAGGGCAGAAAGTGCAGG + Intergenic
1185039949 22:48498715-48498737 GGGCCCCTGGCATCAAGTGGGGG - Intronic
1185215955 22:49600115-49600137 AGCCCCCGGGCAGCATGTCAGGG + Intronic
1185351649 22:50342878-50342900 ACGCCCCGAGCAGCAGGAGCGGG - Intergenic
952125037 3:30290610-30290632 AGGCCCCTGGTGCCAAGTGCTGG - Intergenic
954112790 3:48444808-48444830 AGGTCCAGGGCAGCAGCTGCGGG + Intergenic
954712329 3:52511375-52511397 GGGCCCCAGGCTCCAAGTGCAGG + Intronic
956744703 3:72302068-72302090 AGGCCCCAGGCAGCGTGTGATGG - Intergenic
961734623 3:128993739-128993761 AGGCCGGGGGCAGCACGTGCAGG + Intronic
964757136 3:160098498-160098520 AGGCCCCGGGCAAGAACTGAAGG + Intergenic
966851105 3:184165386-184165408 AGGCCCTGAGCAGCAGGTGGAGG - Intronic
968477893 4:820936-820958 ACGGCCCAGGCAGGAAGTGCAGG - Intronic
968896434 4:3406555-3406577 CGGCCCCCGACAGCAACTGCAGG - Intronic
969442791 4:7227256-7227278 AGGCCTCAGGCTGCAAGTGGGGG - Intronic
969700537 4:8765328-8765350 AGGCCCTTGGCTGCAAGGGCAGG + Intergenic
972654772 4:41054059-41054081 AGGCCCAGGGCTGCAGGTGTTGG + Intronic
973878090 4:55241533-55241555 TTGCGCTGGGCAGCAAGTGCGGG - Intergenic
977320695 4:95512010-95512032 AGACACTGGGCACCAAGTGCTGG + Intronic
980750176 4:137077410-137077432 AGGCCCAGGTCTGCAACTGCAGG + Intergenic
981942210 4:150294483-150294505 AGGCCCAGGGCAGAAAGTAAAGG + Intronic
984760618 4:183359806-183359828 AGGCCCTGGGCAGGAACAGCTGG + Intergenic
985657096 5:1137833-1137855 AGGCCCCGGGGAGCTGGTGCCGG - Intergenic
985813756 5:2111242-2111264 AGGACCCGGGCATCAAAGGCGGG + Intergenic
986151346 5:5133072-5133094 AGGCTGTTGGCAGCAAGTGCAGG - Intergenic
987303302 5:16616572-16616594 GGGCCCCGGGGACCCAGTGCAGG - Intronic
993047196 5:82881047-82881069 AGGCCCCAGGAGGCATGTGCAGG + Intergenic
995759026 5:115544513-115544535 AGTCCCCGGGCAGGTAGTGGCGG - Exonic
997518424 5:134506713-134506735 AGGCTCTTGGCAGCAAGTACTGG + Intergenic
997853657 5:137354659-137354681 AGGGCCCGGCCATCAACTGCAGG + Intronic
1000343919 5:160298511-160298533 AGGCCCAGGGGAGCAGGCGCTGG - Intronic
1001746709 5:174098189-174098211 AGGCCCAGAGAAGCAACTGCAGG + Intronic
1002576107 5:180175064-180175086 GAGCCCTGGGCAGCAGGTGCTGG - Intronic
1002591222 5:180292450-180292472 GGGCCTCGGGCTGCAGGTGCAGG + Intergenic
1002632595 5:180591246-180591268 AGGCCGCGGGCTGCAGGCGCGGG + Intronic
1002799825 6:511728-511750 AGGCTCAGGGCAGCAAGGGCAGG + Intronic
1003095561 6:3140396-3140418 GGACCCGGGGCAGCAGGTGCCGG - Exonic
1006364978 6:33610009-33610031 AGGGTCCAGGCAGCAGGTGCTGG - Intergenic
1007464794 6:42044178-42044200 AGGCTCCGGCCAGAACGTGCAGG - Intronic
1009985693 6:70778979-70779001 GGTCCCTGGGCAGCATGTGCAGG + Intronic
1010887621 6:81263565-81263587 AAGCCCCGGGCAGAAAGGGATGG - Intergenic
1013065852 6:106683995-106684017 AGGACCCGGTCAGCAAGTACAGG + Intergenic
1013117799 6:107115529-107115551 CCGCCCCGGGCAGCCAGCGCGGG - Intergenic
1015492122 6:133838100-133838122 AGCCCCCGGGGAGCAGGCGCGGG - Intergenic
1016372478 6:143389867-143389889 AGACCTCGTGCAGCAAGTGCAGG + Intergenic
1019343639 7:519682-519704 AGGCCCCGGGCGGCGGGTGGTGG - Intronic
1019536250 7:1531134-1531156 ATGGCCCGGGCGGCACGTGCAGG - Intronic
1019619613 7:1985187-1985209 CGGCCCCGGGCAGCATGGGTAGG + Intronic
1020016319 7:4834161-4834183 CGGCCCCTGGCAGCAAGCACAGG + Intronic
1022528344 7:31052420-31052442 CGGCCCCGGGCAGGGAGTGACGG + Intergenic
1023912792 7:44567366-44567388 AGGCTGTGGGCAGCAAGTGCAGG - Intronic
1024311265 7:47971408-47971430 AGTCCCCGGGCAGCAAGAGCAGG - Intronic
1027333839 7:77127225-77127247 AGGCCCAGGTCAGCAGCTGCTGG + Intronic
1030108687 7:106008376-106008398 AGGCCCAGGGAAGCCAGTGGAGG - Intronic
1030236872 7:107273242-107273264 TGGCCCTGGGCAGTAAATGCAGG + Intronic
1030641240 7:112009127-112009149 AGGGCAAGGGCAGCATGTGCTGG - Intronic
1032223093 7:130008977-130008999 AGGGGACAGGCAGCAAGTGCCGG + Intergenic
1033368568 7:140689628-140689650 ATGCCCGGGCCAGCGAGTGCAGG + Exonic
1034417312 7:150971932-150971954 GCACCCCGGGCAGCAGGTGCTGG - Intronic
1034430911 7:151040767-151040789 GGGACCCGGGCAACAAGGGCTGG + Intronic
1035436792 7:158865460-158865482 AGGCCCTGGGGAGCTGGTGCTGG + Intronic
1036244476 8:7104550-7104572 AGGCCCCTTGCAGAAAGAGCTGG - Intergenic
1036755065 8:11466388-11466410 AGGAGCCGGGCAGCCAGGGCTGG - Intronic
1036798091 8:11770091-11770113 AGCCCCCGGGCAGGGAGGGCCGG + Exonic
1036897357 8:12646853-12646875 AGGCCCCGTGCAGAAGGAGCTGG + Intergenic
1037847820 8:22299819-22299841 ACGCCATGGGCAGCAAATGCTGG + Intronic
1041271967 8:56117777-56117799 GGCCCCAGCGCAGCAAGTGCAGG - Intergenic
1041689843 8:60678507-60678529 GGGCCGCGGGCCGCAAGGGCGGG - Intergenic
1042669007 8:71240247-71240269 AGGCCTGGGGCAGAAAGTTCTGG - Intronic
1042839393 8:73108530-73108552 AGGCACAGTGCAGCAAGTTCTGG - Intronic
1046239939 8:111477177-111477199 AGGTCCAGGGCAGAAAGTGAAGG - Intergenic
1049277740 8:141728368-141728390 AGGCCCCGGGTAGCAGCAGCTGG - Intergenic
1049488658 8:142879513-142879535 GGGTCCTGGGCAGCAAGGGCAGG + Intronic
1053604492 9:39643013-39643035 AGCCACCAGACAGCAAGTGCAGG - Intergenic
1054249049 9:62699401-62699423 AGCCACCAGACAGCAAGTGCAGG + Intergenic
1054563163 9:66733934-66733956 AGCCACCAGACAGCAAGTGCAGG + Intergenic
1056757302 9:89389894-89389916 AGGTCACGGGCAGCAGGTGAAGG + Intronic
1057496521 9:95565393-95565415 ACTCCCAGGGCAGCCAGTGCTGG + Intergenic
1057670032 9:97078538-97078560 TGGCCCCGGGCAGGGAGTACTGG + Intergenic
1060198535 9:121638639-121638661 AGGGCCAGGGCAGCTAGGGCAGG + Intronic
1060976258 9:127766954-127766976 AGGCCCTGGGCAAAAAGAGCTGG + Intronic
1061188547 9:129069143-129069165 AGGCCCGGGGGAGCACGAGCTGG + Intronic
1061207925 9:129175140-129175162 AGGCGCGGGGCAGGGAGTGCGGG + Intergenic
1061402512 9:130376112-130376134 AGTCACCGGGCAGCTAGGGCGGG + Intronic
1189653037 X:43210862-43210884 AGGCCCCAGGCTGAAAGTGAAGG + Intergenic
1195884611 X:109625386-109625408 AGGCCCCAGGCAGCAGACGCTGG + Intronic
1199871059 X:151899422-151899444 GGGGCCAGGGCAGCAAGTGAGGG - Intergenic
1200065539 X:153502656-153502678 AGGCCCTGGGCTGCAACTGTGGG + Intronic
1200103828 X:153701548-153701570 AGGCCTAGGGCAGCAGGTGATGG + Intronic
1200110449 X:153738143-153738165 TGGCCCCGGGCAGCACAAGCAGG + Intronic
1200246748 X:154530570-154530592 AGAACCCGGGCCACAAGTGCAGG + Intergenic