ID: 1179628516

View in Genome Browser
Species Human (GRCh38)
Location 21:42662270-42662292
Sequence CCGGACACGGCACCGTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 62}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179628516_1179628522 -10 Left 1179628516 21:42662270-42662292 CCCCAGCACGGTGCCGTGTCCGG 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1179628522 21:42662283-42662305 CCGTGTCCGGGCGTGCGTGAAGG 0: 1
1: 0
2: 0
3: 3
4: 48
1179628516_1179628526 21 Left 1179628516 21:42662270-42662292 CCCCAGCACGGTGCCGTGTCCGG 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1179628526 21:42662314-42662336 ACCTCACAGCTCTGCTTCCCAGG 0: 1
1: 0
2: 3
3: 56
4: 543
1179628516_1179628523 -9 Left 1179628516 21:42662270-42662292 CCCCAGCACGGTGCCGTGTCCGG 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1179628523 21:42662284-42662306 CGTGTCCGGGCGTGCGTGAAGGG 0: 1
1: 0
2: 0
3: 1
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179628516 Original CRISPR CCGGACACGGCACCGTGCTG GGG (reversed) Intronic
900130300 1:1084557-1084579 CCGGACGCTGCACTGGGCTGAGG - Intronic
900173572 1:1282055-1282077 CCGGACACAGCACAGGCCTGGGG - Intronic
900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG + Exonic
902802381 1:18838479-18838501 CCGGACAAGGAACTGTGCTATGG - Intergenic
904877529 1:33667992-33668014 CAGGACATGGCAGAGTGCTGAGG + Intronic
919887205 1:201943497-201943519 ACAGACACAGCACCGTGCTGGGG - Intronic
1076770403 10:132659749-132659771 CCTGACTCGGGACAGTGCTGGGG - Intronic
1081744637 11:45464304-45464326 GAGGACAAGGCACAGTGCTGTGG + Intergenic
1083822747 11:65182080-65182102 CCCGAGAAGGGACCGTGCTGGGG - Intronic
1096531332 12:52244486-52244508 CAGGGCAGGGCACCGAGCTGTGG + Intronic
1101586603 12:106090719-106090741 CTGGCCGGGGCACCGTGCTGAGG - Intronic
1101635421 12:106536239-106536261 ACGGACAGAGCAGCGTGCTGAGG - Intronic
1107459851 13:40591314-40591336 CTGGACACGGCACCATGAGGAGG + Intronic
1112294387 13:98173852-98173874 CCTTACACAGCACCCTGCTGGGG - Intronic
1113716900 13:112516411-112516433 GCGGACCCGTGACCGTGCTGGGG + Intronic
1119260016 14:73232455-73232477 CCGGAAAGGGCACCGGGATGCGG - Intergenic
1126354053 15:47776044-47776066 CAGGACAAGGCACTGTGCTCTGG + Intergenic
1132163895 15:99566256-99566278 CCGGACACGGCCTCGTCCAGGGG - Intronic
1132826068 16:1906296-1906318 AGGGACACGGCACAGGGCTGGGG - Intergenic
1133412104 16:5577536-5577558 CAGCACAAGGCCCCGTGCTGGGG - Intergenic
1139563331 16:67757498-67757520 CTGGACACGGCCCCATGCTCAGG - Intronic
1139971343 16:70777568-70777590 AGGGAAACGGCACTGTGCTGTGG + Intronic
1141676138 16:85518343-85518365 GCGGTCAGGGCACCGTCCTGTGG - Intergenic
1142423986 16:89991033-89991055 CTGGTCAAGGCACGGTGCTGAGG - Intergenic
1160863970 19:1249234-1249256 CCGGCCACGTCACCGAGGTGCGG + Intronic
1160890750 19:1377554-1377576 GCAGCCCCGGCACCGTGCTGTGG - Exonic
1167486697 19:49767082-49767104 CCGGACAGGGCACAGAGCAGCGG - Intronic
1168335337 19:55593964-55593986 CTGGACACGGCACACTCCTGTGG + Intronic
1168699462 19:58428028-58428050 CCAGACACCTCACTGTGCTGGGG + Intergenic
938337594 2:130513079-130513101 CCTGGCACTGCACCCTGCTGAGG + Intergenic
938352245 2:130607656-130607678 CCTGGCACTGCACCCTGCTGAGG - Intergenic
940567690 2:155388819-155388841 CAGGACACGGGACAGAGCTGGGG + Intergenic
945132234 2:206585180-206585202 CCGGACAGGGCAGCATGCGGAGG - Intronic
1170932957 20:20785429-20785451 CCCCACACTGCACCTTGCTGTGG - Intergenic
1173916100 20:46709708-46709730 CGGGACTCGGCGGCGTGCTGGGG - Exonic
1175911578 20:62407625-62407647 CCGGACAGGGAAGTGTGCTGGGG - Intergenic
1179299221 21:40091387-40091409 CAGGACACTGGACCCTGCTGGGG - Intronic
1179628516 21:42662270-42662292 CCGGACACGGCACCGTGCTGGGG - Intronic
1179808473 21:43854978-43855000 CCGGACACGGCTCCATGGGGAGG - Intergenic
1180165000 21:46020761-46020783 CCAGAGGCGGCACAGTGCTGAGG + Intergenic
1181111878 22:20607152-20607174 CAAGAGACGGCACCGTGATGGGG + Intergenic
1182954683 22:34411566-34411588 CAGGACATGGCAGGGTGCTGTGG + Intergenic
1183048602 22:35241889-35241911 CCGGACAGAGCAGCGTGCTGAGG - Intergenic
1183188507 22:36306368-36306390 CCGGGCAGGGCACTGTGGTGTGG - Intronic
1183526490 22:38326166-38326188 CCGGGCACGGCCCAGTGGTGAGG - Intronic
1185286437 22:50001975-50001997 CTGAACACAGCACCCTGCTGAGG + Intronic
954627789 3:52032067-52032089 CCGGCCAGGACACCATGCTGTGG - Intergenic
955492727 3:59499364-59499386 CCGTGCACGGCACTGGGCTGAGG + Intergenic
959698574 3:109275907-109275929 CAGAACTCCGCACCGTGCTGGGG - Intergenic
967981647 3:195069553-195069575 CCGGGCAGGTCACTGTGCTGAGG - Exonic
971737477 4:30474377-30474399 CTGGACACAGCGCTGTGCTGTGG - Intergenic
984519897 4:180788722-180788744 CAGGATTCGGCACCGGGCTGTGG - Intergenic
985881025 5:2639271-2639293 CCGGTCACTGAGCCGTGCTGCGG - Intergenic
986977677 5:13411607-13411629 CTGGACCCAGCACAGTGCTGTGG - Intergenic
1002527160 5:179821180-179821202 CCGGACACGGCCTCCTGCCGCGG + Intronic
1009968633 6:70603867-70603889 CTGGACACAGCAGCGTGCGGAGG + Intergenic
1018860643 6:167708584-167708606 CTGGATGCGGCGCCGTGCTGTGG - Intergenic
1020006769 7:4787590-4787612 TCGGACACGGCTCGGAGCTGTGG - Intronic
1042398708 8:68320867-68320889 GGGGACAGGGCACAGTGCTGAGG - Intronic
1042648331 8:71012097-71012119 CCGTACTCAGCACTGTGCTGGGG + Intergenic
1053476540 9:38385949-38385971 CCTGACAAGGGACTGTGCTGGGG + Intergenic
1061592652 9:131607982-131608004 CCGGAAGAGGCACCATGCTGTGG - Intronic
1062026660 9:134343750-134343772 CCGGGCGCGGCACTGAGCTGAGG + Intronic
1062137229 9:134935786-134935808 CCAGTCTCGCCACCGTGCTGGGG - Intergenic
1186248056 X:7636129-7636151 CAGGACACGGCGGCTTGCTGAGG - Intergenic