ID: 1179628812

View in Genome Browser
Species Human (GRCh38)
Location 21:42664322-42664344
Sequence CACAGGGACGTGCCACCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179628810_1179628812 -8 Left 1179628810 21:42664307-42664329 CCAGTCTCAGCCTGGCACAGGGA 0: 1
1: 0
2: 3
3: 36
4: 568
Right 1179628812 21:42664322-42664344 CACAGGGACGTGCCACCTGCAGG 0: 1
1: 0
2: 1
3: 13
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179628812 Original CRISPR CACAGGGACGTGCCACCTGC AGG Intronic
901317311 1:8317959-8317981 CACCGGGACGGGCCTCCCGCGGG + Intronic
901700714 1:11043676-11043698 CTCAGGGGCTGGCCACCTGCAGG - Intronic
904598184 1:31659647-31659669 CTCTGGAACGTGCCACCTGGGGG - Intronic
905516427 1:38565206-38565228 CACAGGGGGGTGCCAAGTGCAGG - Intergenic
905875869 1:41431862-41431884 CAGCGGGAGGTGCCCCCTGCCGG + Intergenic
906176985 1:43783224-43783246 CACAGGTCCATGCCACCTGCAGG + Intronic
906692668 1:47802868-47802890 CACAGGTCCCTCCCACCTGCAGG + Intronic
907421056 1:54347704-54347726 CACAGGGAGGTGCCATGTGATGG + Intronic
907422058 1:54354271-54354293 CCCAGGCACCTGCCACATGCAGG + Intronic
910333701 1:86104987-86105009 CACAGGGACGAGGCACTGGCAGG + Intronic
910832327 1:91473494-91473516 TCCAGGGTCTTGCCACCTGCAGG - Intergenic
910924567 1:92385031-92385053 TACAGGCAGGTGCCACCTGTAGG - Intronic
915270902 1:154752723-154752745 CACACAGACATGCCCCCTGCTGG + Intronic
915858951 1:159422039-159422061 CACATGAATGTGCCACCTGCAGG - Intergenic
916297405 1:163235023-163235045 CACAGGGACATCCCAGCTTCAGG + Intronic
918081967 1:181214693-181214715 CTCAGGGCCTTGGCACCTGCTGG + Intergenic
918727342 1:187942322-187942344 CACAAGGTCCTGCCTCCTGCTGG - Intergenic
921746906 1:218750384-218750406 CACAGCAATGTGTCACCTGCGGG - Intergenic
924261332 1:242234617-242234639 CACCTGGAGATGCCACCTGCTGG + Intronic
1063270965 10:4509646-4509668 CACAGGGAAGTGGCACCCCCAGG - Intergenic
1066659974 10:37728979-37729001 CACAGAGCCATGCCATCTGCAGG - Intergenic
1067793652 10:49305654-49305676 CCCATGGACCTGCCACCAGCGGG + Intronic
1068192352 10:53667907-53667929 GACAGGGCAGTTCCACCTGCAGG - Intergenic
1071490520 10:86133449-86133471 CCCAGGAACGTCCCACCTGCAGG + Intronic
1071826318 10:89329606-89329628 CACTGGCACGTGCCAGCTGATGG + Intronic
1077233871 11:1470659-1470681 CACAGGGACTTGCCAACCCCGGG + Intronic
1078338003 11:10478792-10478814 CACAGGGTCGTGCCTCCCTCTGG + Intronic
1083475227 11:62910965-62910987 CACAGTGACAGGCAACCTGCTGG - Exonic
1083629548 11:64088536-64088558 TAAAGGGTGGTGCCACCTGCAGG - Intronic
1084533888 11:69745722-69745744 CACAGGCCAGTGCCGCCTGCTGG - Intergenic
1089567840 11:119381455-119381477 GGCAGGTACGTGCCACCTGTCGG - Exonic
1090985526 11:131762576-131762598 GACAGGGCCGTCACACCTGCTGG - Intronic
1093926098 12:24909866-24909888 CACATGGAGGAGCCACGTGCAGG + Intronic
1096541808 12:52312251-52312273 GTCATGGACGTGCCACCTGGGGG - Intergenic
1096975796 12:55698678-55698700 TAGAGGGCCGTGCCACCTGAGGG - Intronic
1097848927 12:64392420-64392442 TAAAGAGAAGTGCCACCTGCTGG + Intergenic
1100615375 12:96227535-96227557 CACAGGGACGACCCTCCTCCGGG - Intronic
1100615388 12:96227577-96227599 CACAGGGACGACCCTCCTCCGGG - Intronic
1101575847 12:105995659-105995681 AACAGGGATGAGCCTCCTGCAGG - Intergenic
1102501478 12:113355947-113355969 CACAGGCACATGCCACCACCCGG + Intronic
1102587197 12:113931699-113931721 CACAGGGCCTTTGCACCTGCTGG + Intronic
1102993857 12:117333497-117333519 CAGAGGGAGGTGCCACCTCCTGG + Intronic
1103684636 12:122722292-122722314 CACTGGGAGGTGCCACCTAAGGG + Intergenic
1112630010 13:101150190-101150212 CACACGTCAGTGCCACCTGCTGG - Intronic
1113693429 13:112328023-112328045 CACAGGTAGGTGGCATCTGCCGG - Intergenic
1113866750 13:113531445-113531467 CAGGGCGCCGTGCCACCTGCAGG - Intronic
1119458374 14:74776913-74776935 CACAGGTATGTGCCACCATCTGG - Intronic
1121127666 14:91418124-91418146 CGCAGGGATGCGCCACGTGCTGG - Intergenic
1122785444 14:104161276-104161298 CAGGGGCACCTGCCACCTGCCGG - Intronic
1128557077 15:68639164-68639186 CACAAGGAGGTGCCTCCTTCAGG - Intronic
1129210063 15:74063252-74063274 TACAGGCACGTGCCACCACCAGG - Intergenic
1129476971 15:75792179-75792201 TACAGGCACGTGCCACCACCAGG + Intergenic
1133139597 16:3734480-3734502 CACAGGCAGGTGCCCCCTCCTGG + Intronic
1134215533 16:12314126-12314148 CACAGGTGCATGCCACCAGCAGG + Intronic
1135930293 16:26730556-26730578 CAAAGGGACCTGCCACTTCCAGG - Intergenic
1140945849 16:79767780-79767802 CACAGGCAAGTGCCCTCTGCTGG - Intergenic
1141140459 16:81493786-81493808 CAAAGGGGCGAGTCACCTGCTGG + Intronic
1141505166 16:84472146-84472168 TACATGCACGTGCCACCTGTGGG + Intergenic
1203138333 16_KI270728v1_random:1744452-1744474 CAAATGGACGTGGCATCTGCGGG + Intergenic
1143853024 17:9827010-9827032 TACAGGTACGTGCCACCACCCGG + Intronic
1144495711 17:15743495-15743517 CACTGGGACCTGCCACCCCCAGG + Exonic
1145006571 17:19341937-19341959 CACAGGGAAGCGCCACATGAGGG + Intronic
1145063537 17:19747264-19747286 CACAGGGAGGAGGGACCTGCTGG + Intronic
1145208422 17:20996614-20996636 CACTGGGACCTGCCACCCCCAGG + Intergenic
1146611303 17:34307355-34307377 CACAGGGACTTTCCAACTGCAGG + Intergenic
1147004429 17:37390650-37390672 TACAGGCACATGCCACCAGCTGG - Intronic
1147887475 17:43693957-43693979 CACAGTGGCGTGCCAGCTACTGG - Intergenic
1151162241 17:72175476-72175498 AACAGGGACATGGCACCTGAAGG + Intergenic
1151287991 17:73127376-73127398 GAGAGGGCCGTGCCTCCTGCAGG - Intergenic
1151883073 17:76906287-76906309 CTCAGGGCCGTGGGACCTGCAGG - Intronic
1152433090 17:80260466-80260488 CACTGGGAGGCGCCACCGGCGGG + Intergenic
1152525997 17:80888730-80888752 GTCAGGCACGTGCCACGTGCCGG + Intronic
1152702483 17:81825892-81825914 CACAGGGACATGCTGCCTGCTGG + Exonic
1153354714 18:4122508-4122530 CACAGGGACTTGCCAGCTTGAGG - Intronic
1154083951 18:11283762-11283784 CACAGGGGCTGGCCACGTGCAGG - Intergenic
1157855054 18:51097885-51097907 CACAGGGCTGTGAGACCTGCAGG - Intergenic
1158695075 18:59696870-59696892 CACAGGGACGAGCCACGCGAGGG + Intronic
1160743339 19:698037-698059 CACAGGCACCTGCCACCACCAGG + Intergenic
1161086539 19:2338135-2338157 CACAGGGACATGCCGACTGCTGG + Intronic
1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG + Exonic
1164461956 19:28456524-28456546 CACAGGCATGAGCCACCTGCTGG - Intergenic
1168018885 19:53594694-53594716 CAGAGGGGCTTGCCACCTCCTGG - Intergenic
1168348102 19:55660556-55660578 TACTGGGACGTGCCACCCCCAGG + Exonic
1168707288 19:58477320-58477342 CTCGGGGACCTGCCACCTCCTGG - Exonic
925151865 2:1620381-1620403 CCCAGTGACGTGCCATCAGCTGG + Intergenic
926115205 2:10208877-10208899 CACAGGGACGGGGCATCTGTTGG - Intronic
926419242 2:12681013-12681035 AAGAGGGCCCTGCCACCTGCTGG + Intergenic
929260935 2:39865933-39865955 CACAGGCAGCTGTCACCTGCAGG - Intergenic
930065314 2:47323426-47323448 CAGTGGGACCTGTCACCTGCTGG - Intergenic
930442047 2:51421039-51421061 CACAGGCACATGCCACCAGCAGG - Intergenic
932112452 2:69013415-69013437 CTCAGGGACGCGCCATCCGCGGG - Exonic
932488746 2:72104950-72104972 GACAGGCGCGTTCCACCTGCCGG + Intergenic
934567441 2:95348375-95348397 CAGAGGACCGTGCCTCCTGCAGG + Intronic
934578214 2:95416499-95416521 CACAGGGAGCTGACAGCTGCAGG - Exonic
934601225 2:95660205-95660227 CACAGGGAGCTGACAGCTGCAGG + Intergenic
935182845 2:100705776-100705798 CACAGGGTCGGCCCATCTGCCGG - Intergenic
936534597 2:113302372-113302394 CACAGGGAGCTGACAGCTGCAGG + Intergenic
937906623 2:127055736-127055758 CATGGCGAGGTGCCACCTGCCGG - Intronic
948920687 2:241064624-241064646 CACAGCGGAGTGCCACCAGCCGG - Intronic
949032689 2:241804474-241804496 CACAGGCACGCGCATCCTGCCGG - Intergenic
1171351650 20:24507251-24507273 CACAGGAGCGTGCTGCCTGCTGG + Intronic
1172620300 20:36314056-36314078 CTCAGGGACCTGCCACCTCGGGG + Intronic
1173225203 20:41158476-41158498 CACAGGGAGGGGCTGCCTGCTGG - Intronic
1174451720 20:50624739-50624761 GACGGGCACGTGCAACCTGCCGG + Intronic
1175277579 20:57782726-57782748 CCCAGGGACCTGCTAGCTGCAGG - Intergenic
1175759747 20:61553958-61553980 GACAGGGACCTGGCCCCTGCAGG - Intronic
1175782004 20:61688845-61688867 GACAGGGACGTTTCCCCTGCTGG - Intronic
1176424633 21:6540639-6540661 CACAGGGACGTGCGCACGGCTGG - Intergenic
1177455414 21:21331727-21331749 CACAGGCACGTGCCACCACATGG + Intronic
1179628812 21:42664322-42664344 CACAGGGACGTGCCACCTGCAGG + Intronic
1179700122 21:43148948-43148970 CACAGGGACGTGCGCACGGCTGG - Intergenic
1180514961 22:16132117-16132139 CAGTGGCAGGTGCCACCTGCAGG + Intergenic
1180966223 22:19789229-19789251 GACAGGGAGGTCCCAGCTGCAGG + Intronic
1184335229 22:43848877-43848899 AACAGGGCAGAGCCACCTGCTGG + Intronic
950493364 3:13319453-13319475 CAGAGGGCCAGGCCACCTGCTGG + Intronic
951553144 3:23895421-23895443 CACAAGGACGTACAACCTACTGG + Intronic
951676747 3:25250128-25250150 CACCTGTACATGCCACCTGCAGG - Intronic
953998831 3:47540626-47540648 CACAGTGACCTCCCTCCTGCAGG + Intergenic
956746816 3:72317089-72317111 CGCATGGAGGTGCCACGTGCAGG + Intergenic
960948822 3:122985359-122985381 TACAGGCAAGTGCAACCTGCTGG - Intronic
962915808 3:139902397-139902419 CTCAGGGCAGTGGCACCTGCTGG + Intergenic
965030475 3:163359170-163359192 TACAGGCACGTGCCACCACCTGG - Intergenic
967087469 3:186108439-186108461 CACAGGCAAGTGCAGCCTGCGGG - Intronic
967592606 3:191296207-191296229 CACAAGGACTTTGCACCTGCAGG + Intronic
969292643 4:6250582-6250604 CACAGGGAAGCGCCTCCTGTGGG + Intergenic
969584104 4:8082130-8082152 AACAGGGCCTTGCCGCCTGCAGG + Intronic
970619107 4:17798696-17798718 CACAGTGACCTGACACTTGCTGG - Intergenic
974072021 4:57132569-57132591 CACATGCATGTGCCACCTGTGGG + Intergenic
977667589 4:99658829-99658851 CACAGGGTCATGCCCACTGCTGG + Intergenic
978446197 4:108782360-108782382 TACAGGTATGAGCCACCTGCCGG + Intergenic
983819167 4:172171695-172171717 CACAGACACGTGCCACCACCCGG - Intronic
985475664 5:77626-77648 CACAGGAAAGAGCCACCTGCAGG - Intergenic
985840128 5:2299841-2299863 CCCAGGGTCAAGCCACCTGCTGG - Intergenic
992433355 5:76731331-76731353 TACAGGCACGTGCCACCAGAGGG - Intronic
996077563 5:119214897-119214919 TAGAGGGATGTGCCACTTGCTGG - Intronic
1000312294 5:160056580-160056602 TACAGGCACATGCCACATGCCGG - Intronic
1000928978 5:167229553-167229575 CACTTGTACCTGCCACCTGCAGG - Intergenic
1001299490 5:170523651-170523673 CCCAGGGAGGTGACACGTGCAGG - Intronic
1001364532 5:171123228-171123250 TACAGGCACATGCCACCTGCTGG + Intronic
1001841763 5:174882276-174882298 CACAGGTGTGTTCCACCTGCTGG + Intergenic
1002041844 5:176520492-176520514 CACAGGGAAGAGCCACCTGCAGG + Intergenic
1002692270 5:181058886-181058908 CGCAGGGTGGTGCCACCAGCAGG + Intronic
1004886188 6:20053698-20053720 CCCAGGAAGGTGCCACCAGCGGG - Intergenic
1006401935 6:33822769-33822791 CACAGGGATGTGCCAGCGCCGGG - Intergenic
1007231198 6:40348765-40348787 CCCAGGGAAGTGGCTCCTGCTGG - Intergenic
1017107956 6:150905968-150905990 CACAGTGAAGTGCCCCCTACTGG + Intronic
1019083004 6:169448820-169448842 CACAGTGAGGAGACACCTGCAGG + Intergenic
1020634942 7:10685203-10685225 CTCAGGAAAGTGCCACCTCCTGG + Intergenic
1021449022 7:20764434-20764456 TACAGGTGCATGCCACCTGCCGG + Intronic
1023868374 7:44249663-44249685 CACCAGGAAGTGCCACCTCCCGG + Intronic
1028262962 7:88686716-88686738 CACAGGGGCCTGCCCCATGCTGG + Intergenic
1031613125 7:123850380-123850402 CACAGGAACGCACCACCAGCCGG + Intronic
1033230293 7:139592274-139592296 CACAGTGAAGTGCAGCCTGCAGG + Intronic
1033412575 7:141132553-141132575 CACCTGCACGTGCCACCTGGGGG + Intronic
1034226570 7:149489548-149489570 CTCAGGCAGGTCCCACCTGCAGG - Intronic
1034241626 7:149615806-149615828 CTCAGGCAGGTCCCACCTGCAGG - Intergenic
1036751714 8:11447654-11447676 CACAGGCAGGTGCCAGCAGCTGG + Intronic
1037787330 8:21910789-21910811 CAGTGAGAGGTGCCACCTGCGGG - Exonic
1037881645 8:22576372-22576394 CACAGGGACCTGCAAGCTCCAGG - Intergenic
1039016657 8:33156989-33157011 CACAGGCATGTGCCACCACCTGG - Intergenic
1043955422 8:86353631-86353653 TATAGGTACGTGACACCTGCTGG + Intronic
1049058836 8:140259820-140259842 CACAGGGCCTGGCCACCAGCAGG + Intronic
1049553840 8:143272659-143272681 CTCAGTCACCTGCCACCTGCTGG - Intronic
1049691481 8:143962428-143962450 CACAGGGAAGAGCCACAGGCAGG - Intronic
1053505876 9:38642761-38642783 CACCTGGAAGTGACACCTGCTGG + Intergenic
1060741331 9:126099501-126099523 CCCAGGGCAGTGCCACCTTCTGG + Intergenic
1061249857 9:129420371-129420393 CACAGGGAAGCGCCCCCTGACGG - Intergenic
1061872547 9:133528534-133528556 CACTGGGGCCTGCCATCTGCTGG - Intronic
1062186772 9:135222423-135222445 CACAGGGCCAGGCCTCCTGCAGG + Intergenic
1062385414 9:136309072-136309094 CCGTGGGAGGTGCCACCTGCAGG - Intergenic
1062592932 9:137282075-137282097 CACCTGGAGGTGTCACCTGCCGG + Exonic
1187124218 X:16438429-16438451 TACAGGCACATGCCACCAGCAGG - Intergenic
1187951940 X:24479642-24479664 TACAGGCACGTGCCACCGCCTGG - Intronic
1189491649 X:41475044-41475066 CACAGGGACGTGCCACTCGAGGG + Exonic
1193497222 X:82230206-82230228 TACCTGGAAGTGCCACCTGCTGG - Intergenic
1199996141 X:153028044-153028066 CACGGGGAAATGCCACCTTCAGG - Intergenic
1200073692 X:153541046-153541068 CACAGGGACCTGGGACCCGCTGG + Intronic