ID: 1179630061

View in Genome Browser
Species Human (GRCh38)
Location 21:42672255-42672277
Sequence GCACGCACCCCTGGAGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 171}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179630055_1179630061 17 Left 1179630055 21:42672215-42672237 CCTTCGTTCAGACCACAGCTGAA 0: 1
1: 0
2: 0
3: 11
4: 165
Right 1179630061 21:42672255-42672277 GCACGCACCCCTGGAGCTGAGGG 0: 1
1: 0
2: 0
3: 13
4: 171
1179630057_1179630061 5 Left 1179630057 21:42672227-42672249 CCACAGCTGAAGGTCTGACTTAG 0: 1
1: 0
2: 0
3: 14
4: 200
Right 1179630061 21:42672255-42672277 GCACGCACCCCTGGAGCTGAGGG 0: 1
1: 0
2: 0
3: 13
4: 171
1179630054_1179630061 22 Left 1179630054 21:42672210-42672232 CCTCGCCTTCGTTCAGACCACAG 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1179630061 21:42672255-42672277 GCACGCACCCCTGGAGCTGAGGG 0: 1
1: 0
2: 0
3: 13
4: 171
1179630053_1179630061 25 Left 1179630053 21:42672207-42672229 CCACCTCGCCTTCGTTCAGACCA 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1179630061 21:42672255-42672277 GCACGCACCCCTGGAGCTGAGGG 0: 1
1: 0
2: 0
3: 13
4: 171
1179630052_1179630061 26 Left 1179630052 21:42672206-42672228 CCCACCTCGCCTTCGTTCAGACC 0: 1
1: 0
2: 1
3: 7
4: 61
Right 1179630061 21:42672255-42672277 GCACGCACCCCTGGAGCTGAGGG 0: 1
1: 0
2: 0
3: 13
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179630061 Original CRISPR GCACGCACCCCTGGAGCTGA GGG Intronic
900075101 1:808093-808115 GCATGAACCCCTGATGCTGATGG - Intergenic
900366242 1:2313038-2313060 GCACCCAGCCCTGGAGCAGGTGG + Intergenic
900526216 1:3130089-3130111 GCACGCAGCCCAGGACCTGTTGG - Intronic
900614918 1:3561151-3561173 GCACGCAGACCTGAGGCTGATGG + Intronic
900991962 1:6102140-6102162 CCAAGCACCCCTGGAGAGGAAGG - Exonic
901173714 1:7283416-7283438 GCAAGTACCACTGGAGCTGTAGG - Intronic
901425225 1:9178467-9178489 GCACCCAGCCCTGAAGGTGAGGG + Intergenic
902688681 1:18096004-18096026 GCACCCAGCCCTGGAGCTGGAGG + Intergenic
902957943 1:19939465-19939487 GGACCCACCCTTGGATCTGAGGG + Intergenic
903344764 1:22677151-22677173 GCCCGCTCCCCAGGAGCAGATGG - Intergenic
903938036 1:26910138-26910160 GCACGCACCCTTGCACCTGAGGG - Intronic
904271040 1:29350261-29350283 GAACCCGGCCCTGGAGCTGAGGG + Intergenic
904362205 1:29983589-29983611 GAATCCAGCCCTGGAGCTGAGGG + Intergenic
905029015 1:34869025-34869047 GCAGGCAGACCTGGAGCTGGAGG - Exonic
907401635 1:54228298-54228320 CCAGGCACCCCTCGAGATGACGG - Exonic
912145904 1:106794286-106794308 GAAAGAACCCCTGGAGCTGCTGG - Intergenic
919789840 1:201283980-201284002 GCACGCATCCCCGGGGATGAGGG + Intronic
919834962 1:201567206-201567228 CCACTCCCCCCTGCAGCTGATGG - Intergenic
920177028 1:204108444-204108466 CCATCCATCCCTGGAGCTGATGG - Intronic
921849109 1:219915724-219915746 GAAGGAACCCCTGGAGCAGAAGG - Exonic
921866657 1:220094101-220094123 GCACGCGCTCCGGGAGCGGAAGG - Exonic
922270941 1:224032992-224033014 GCATGAACCCCTGATGCTGATGG - Intergenic
924567388 1:245210126-245210148 GCAGACACCCTGGGAGCTGATGG - Intronic
1062760299 10:12277-12299 GTGCGCACACCTGGAGGTGAAGG + Intergenic
1062816474 10:504853-504875 GTCAGCACCGCTGGAGCTGAGGG - Intronic
1063024896 10:2168211-2168233 CCAGGCACCCCTGGATCTCACGG - Intergenic
1063199177 10:3770977-3770999 GCACGTTCCCCTAGATCTGAGGG - Intergenic
1063954198 10:11250950-11250972 GCACGCACCTCTGGAGCACAAGG - Intronic
1065287759 10:24202039-24202061 GCAGCCACACCTGGAGCTGAGGG - Intronic
1076117314 10:127909172-127909194 ACACGCATCCCTGGAGAAGAGGG - Intronic
1077496284 11:2888014-2888036 GAAGGCACCCCAGGAGCTGGGGG + Exonic
1077669443 11:4144452-4144474 TCAAGCACCACTGGATCTGATGG - Intergenic
1083419585 11:62545624-62545646 GCGCGCACCGCTGGAGCGCAGGG + Intronic
1083466247 11:62848373-62848395 GCAAGCTCCTCTGGAGCTTAGGG + Intergenic
1084529633 11:69719243-69719265 CCAGGCACCCCGGGAGCCGATGG + Intergenic
1090436892 11:126694507-126694529 CCACACCCGCCTGGAGCTGATGG - Intronic
1090765489 11:129872816-129872838 GCAGGGACCACTGGAGCTGGAGG - Intronic
1090844084 11:130516574-130516596 CCAGGGACCCCTGGAGCTGCAGG + Intergenic
1095982807 12:47982572-47982594 GCAGGCCCCCCTGGGGCTCAGGG - Exonic
1096868257 12:54577919-54577941 CCACGCTCCCTTGGAGCAGATGG - Exonic
1102617179 12:114164832-114164854 GCATGCACCCCAGGAGTTGACGG + Intergenic
1105512360 13:21061339-21061361 GACCGCGCCCCTGGAGGTGAGGG - Exonic
1105701823 13:22940165-22940187 GCACCCATCCCTGGGGCAGAGGG - Intergenic
1105800010 13:23894822-23894844 GCACGCCGACCTGGAGCTCAGGG - Intronic
1105849023 13:24318177-24318199 GCACGCCGACCTGGAGCTCAGGG + Intronic
1110648841 13:77919493-77919515 GCACGCCTCCCTTGAGCTGCAGG + Exonic
1111123033 13:83879340-83879362 GCAGGCACCCCGGGGGCTGGAGG - Exonic
1113422830 13:110183219-110183241 CCAGGCCCCCCTGGAGCAGAAGG - Exonic
1113486223 13:110654173-110654195 GCACACACCCCTGGAGCCCCTGG + Intronic
1114121000 14:19669908-19669930 CCAGGCACCCCTCGAGATGACGG + Intergenic
1114525659 14:23365806-23365828 GCAGGCACCCCTGGAACAGGCGG + Intergenic
1121271503 14:92641101-92641123 GGAAGCTTCCCTGGAGCTGAGGG - Intronic
1123067579 14:105626312-105626334 GCAGGCACCCCTGCAGCCTAGGG + Intergenic
1123076557 14:105670092-105670114 GCAGGCACCCCTGCAGCCTAGGG + Intergenic
1123114501 14:105888488-105888510 GCACCCACTCCTGGGACTGAGGG - Intergenic
1123116660 14:105897894-105897916 ACACCCACTCCTGGGGCTGAGGG - Intergenic
1125590711 15:40853173-40853195 CCAGGAACCCCTGGTGCTGAAGG + Exonic
1127302341 15:57667281-57667303 GCCCACACCCCTGGGCCTGAGGG + Intronic
1129250231 15:74304687-74304709 GCCCCCAGCCCTGGAGCTGGCGG + Intronic
1132148984 15:99446621-99446643 GCCTGCACCACTGGGGCTGAAGG - Intergenic
1133058917 16:3161677-3161699 GGGCGCACCACGGGAGCTGAGGG - Intergenic
1135509962 16:23073898-23073920 GCAGCCTCCCCTGGTGCTGATGG - Intronic
1135560119 16:23469687-23469709 CCATGCAACCCTGGAGCTGTGGG + Intronic
1137756095 16:50903581-50903603 GCACCCATCCCTGGAGCTAGTGG + Intergenic
1140592248 16:76367801-76367823 TGAAGGACCCCTGGAGCTGATGG - Intronic
1142596327 17:1031675-1031697 GCGCGAACCCCTGGCGCTGGAGG - Intronic
1142633758 17:1243603-1243625 GCATCTATCCCTGGAGCTGAGGG + Intergenic
1147048226 17:37770789-37770811 CCACCCACCCCTGGAAGTGAGGG + Intergenic
1148126788 17:45241465-45241487 GCCCTCGGCCCTGGAGCTGAAGG + Exonic
1148228213 17:45914252-45914274 GACCACACCCCTGGAGCAGAGGG + Intronic
1148460846 17:47838281-47838303 CCAGGCAGCCCTGGGGCTGATGG - Exonic
1148616882 17:49007394-49007416 GCACGCAGCCTTTGAGCAGAGGG - Intronic
1151282474 17:73087263-73087285 GCACTGCCCCCGGGAGCTGATGG - Intronic
1151505137 17:74522520-74522542 GCTGGCACCCCAGGAGGTGATGG + Exonic
1152228955 17:79105246-79105268 GCAGGGACCCAGGGAGCTGATGG + Intronic
1152251714 17:79215988-79216010 GGACGCAGGGCTGGAGCTGATGG + Intronic
1152953207 18:12631-12653 GTGCGCACACCTGGAGGTGAAGG + Intergenic
1153525356 18:5989895-5989917 GCAGGCACCACTGGAGGTGAGGG + Intronic
1153688320 18:7567635-7567657 GCCCGCGCCCCTGGAGCCGCTGG + Exonic
1153786035 18:8536494-8536516 TCAGGCACCAGTGGAGCTGAGGG + Intergenic
1160500103 18:79397146-79397168 GCACACACCCCTGGCGATGCCGG + Intronic
1160805584 19:991019-991041 GCACCCTGCCCTGGGGCTGAGGG + Intronic
1161026952 19:2041314-2041336 CCACGCACGCCTGGGGCAGAGGG + Intronic
1161146836 19:2683931-2683953 GCTCGGCCCCCTGGGGCTGAGGG - Intronic
1161975314 19:7605227-7605249 GCACGTGCCCCCGGAGCTGTGGG + Exonic
1162485965 19:10960857-10960879 GCACGCGCGCCGGGAGCGGAAGG + Intergenic
1163151905 19:15420430-15420452 GCAGGCATCCCTGAGGCTGATGG - Exonic
1163304155 19:16467111-16467133 GCAGGCACCACTGCACCTGATGG + Intronic
1163426637 19:17244225-17244247 GCACCCACCCCTGGGGGAGAGGG + Intronic
1165068334 19:33241485-33241507 GCAGGCACTCCTGGGGGTGAGGG + Intergenic
1165938435 19:39403301-39403323 GCCTGGACCCCTGGATCTGAGGG + Intergenic
1166118934 19:40673479-40673501 CCATGCACCCCTGGAGCAGCTGG - Exonic
1166118949 19:40673529-40673551 GCAGGCACCCCTGTGGCTGCAGG - Exonic
1166297528 19:41896381-41896403 TGACGCCCCCCTGGAGCTGGGGG + Exonic
1166662131 19:44654126-44654148 GCCCGGACCCCTGGGTCTGAGGG + Intronic
1167669005 19:50839025-50839047 GCCCGCACTCCTGGGTCTGAGGG + Intergenic
926096390 2:10083527-10083549 GCAGTCACACCTGCAGCTGAAGG + Intergenic
937852587 2:126648857-126648879 TCAAGCACCACTGGATCTGATGG + Intergenic
937888055 2:126913988-126914010 GCACACAGCCCTGGACCTCAAGG - Intergenic
938273344 2:129993945-129993967 CCAGGCACCCCTCGAGATGACGG + Intergenic
945790117 2:214294041-214294063 GCATCCTGCCCTGGAGCTGATGG - Intronic
948711932 2:239830641-239830663 GCCTGCACAGCTGGAGCTGAAGG - Intergenic
948829223 2:240589647-240589669 GCACCCCCCCCTGCAGCAGAGGG - Intronic
949082622 2:242116691-242116713 GCATGAACCCCTGATGCTGATGG + Intergenic
1168972922 20:1943068-1943090 GCAAGAACCCCCGGAGGTGAAGG - Intergenic
1169491809 20:6077414-6077436 GGACTGGCCCCTGGAGCTGAGGG + Intronic
1170969008 20:21101557-21101579 GCCCGAGCCCCTGGAGCTGGCGG - Intergenic
1173822794 20:46029774-46029796 GCAGGCACCCGTGGAGCCGGGGG + Intronic
1175934422 20:62508464-62508486 GCAGACCCCCCTGGAGCTGAGGG + Intergenic
1176292524 21:5053818-5053840 GCCCTCACCCCTGCAGCTGGGGG - Intergenic
1178003846 21:28194323-28194345 GCACCCAACCCTGGAGCACATGG + Intergenic
1179104255 21:38384055-38384077 GTCCGCACCCCTGCAGCTGAGGG - Intronic
1179622598 21:42627079-42627101 GCTAGCACTCCAGGAGCTGAGGG - Intergenic
1179630061 21:42672255-42672277 GCACGCACCCCTGGAGCTGAGGG + Intronic
1179807529 21:43849374-43849396 GCAGGCAACGCTGGAACTGAGGG + Intergenic
1179864734 21:44209832-44209854 GCCCTCACCCCTGCAGCTGGGGG + Intergenic
1180004309 21:45013030-45013052 CAACGCACACCTGGAACTGAGGG + Intergenic
1180097080 21:45560799-45560821 GCACCCAGGCTTGGAGCTGAGGG + Intergenic
1180461762 22:15572157-15572179 CCAGGCACCCCTCGAGATGACGG - Intergenic
1181026457 22:20130519-20130541 GCAGACACCACTGGAGCAGATGG - Intronic
1181516098 22:23414720-23414742 GCTCGGAGCCCTGGAGCTGCTGG + Intergenic
1181591652 22:23889257-23889279 GCACGTACCCCAGGATCTCAGGG - Intronic
1184273339 22:43397070-43397092 GCAAGAACCCCTGGGGCTGGGGG + Intergenic
1185244048 22:49763872-49763894 GTGCGCACCCCTGGGCCTGAGGG + Intergenic
950135177 3:10575954-10575976 CCACGCATCCCTGGACATGAGGG - Intronic
950457764 3:13102829-13102851 GGCTGCACCCCTGGTGCTGAGGG + Intergenic
950510053 3:13420466-13420488 GCCCGGGCCCCCGGAGCTGAGGG + Intergenic
954322119 3:49839410-49839432 GCACGCACTCCTGGCACTAAGGG + Intronic
955694553 3:61622979-61623001 GCATCACCCCCTGGAGCTGATGG + Intronic
956384611 3:68703406-68703428 GCACACTTCCCTGGAGCTCAGGG + Intergenic
961041574 3:123682158-123682180 GCAGGCACCCCGGGGACTGAGGG - Intronic
961318982 3:126059628-126059650 GCAGGCAGCCCAGAAGCTGAGGG - Intronic
961405036 3:126672524-126672546 GGGCGGACCCCTGGAGCTGGTGG + Intergenic
961592540 3:127991472-127991494 GCACGCAGGCCTGGGGCTGGCGG + Intergenic
962948712 3:140198447-140198469 GCACTCTCCTCTGGAGCTCAGGG + Intronic
966896753 3:184450693-184450715 TCACGCACCACTGGATCTGCTGG + Intronic
967815554 3:193795553-193795575 TCACGAAGCCCTGGAGATGATGG + Intergenic
968550746 4:1222445-1222467 GCAGGCCCCCCTGGAGCTGCTGG - Intronic
969480889 4:7446292-7446314 CCACCCACCCCAGGAGCTGTGGG + Intronic
969860845 4:10034276-10034298 GCACCCACGCAAGGAGCTGATGG + Intronic
971208099 4:24589657-24589679 GCAAGCACTCCCAGAGCTGAGGG - Intergenic
972655840 4:41062892-41062914 GCACACACCTCTGCAGCTCAGGG + Intronic
972722342 4:41712806-41712828 GAGCCCAGCCCTGGAGCTGATGG - Intergenic
991029568 5:62068664-62068686 GGATGCACCACTGGAGCTGAAGG + Intergenic
999223547 5:150001000-150001022 GCGCGCATCCCGGGGGCTGAAGG - Exonic
999431914 5:151531839-151531861 CCAGGCACCACTGGAGCTCACGG - Exonic
1000273477 5:159710133-159710155 CCACCCACTCCTGGAGCTGGTGG - Intergenic
1001705277 5:173737075-173737097 GCCCCCACCCCTGGGGCTGGGGG + Intergenic
1001925210 5:175631157-175631179 GCACCCACTGCTGGAGGTGATGG + Intergenic
1002176370 5:177403595-177403617 GCCCGCACCCGAGGATCTGACGG - Exonic
1002465046 5:179404049-179404071 CCAGCCACCCCTGGAGCTGGTGG - Intergenic
1002531466 5:179848905-179848927 GCCAGCATCGCTGGAGCTGAGGG + Intronic
1003167558 6:3694351-3694373 TCACGCACCCTTGGATATGATGG + Intergenic
1004780784 6:18906137-18906159 GCACCAGACCCTGGAGCTGAGGG - Intergenic
1005318810 6:24631258-24631280 GCATTCACCGCTGAAGCTGAAGG - Intronic
1009818282 6:68765568-68765590 ACACACACACCTGGAGCAGAGGG + Intronic
1013591488 6:111622690-111622712 GCAGGTAGCCCTGGAGCTGCCGG - Intergenic
1016990025 6:149922454-149922476 GCACGCAGCCCTGGGGGTGCTGG + Intronic
1018923984 6:168194122-168194144 GCAGGGCCACCTGGAGCTGACGG - Intergenic
1023406111 7:39834623-39834645 CCAGGCACCCCTCGAGATGACGG + Intergenic
1023860078 7:44213292-44213314 GCACCCACTCCTGGTGCTCAAGG - Exonic
1024533364 7:50410738-50410760 GCAGGGACCCCAAGAGCTGAGGG + Intergenic
1027229068 7:76261685-76261707 GGAAGGAACCCTGGAGCTGAAGG - Intronic
1029438018 7:100573443-100573465 GCACCCTCCCCTGGAGCCCAAGG + Exonic
1030081970 7:105786096-105786118 GGACACACACCTAGAGCTGAGGG + Intronic
1032429094 7:131846372-131846394 ACACGCATCCCTGGACCTCAAGG - Intergenic
1034147166 7:148883905-148883927 GCGCACACCCCTGGAGCTGCGGG - Intronic
1035083489 7:156236702-156236724 GCACACTGCCCTGGAGCTGCCGG + Intergenic
1035127549 7:156619297-156619319 CAAAGCAGCCCTGGAGCTGAGGG - Intergenic
1035540546 8:433394-433416 GCATGAACCCCTGATGCTGATGG + Intronic
1037825533 8:22158431-22158453 GTCCCCACCCCTGCAGCTGAGGG + Intronic
1038485849 8:27934726-27934748 GCATGAACCCCTGGAGCAGGGGG + Intronic
1042002176 8:64136578-64136600 GCAAGCAAGCCTGTAGCTGATGG - Intergenic
1048150023 8:131885255-131885277 GCACGCATGTCCGGAGCTGAAGG - Intergenic
1048741790 8:137568913-137568935 GTTAGCACCCCTGGACCTGAAGG + Intergenic
1048889202 8:138932874-138932896 TCACTCACGCCTGGAGCTCAGGG + Intergenic
1049373040 8:142276775-142276797 GCATGCAGCCCTGGAGCAGCAGG - Intronic
1051369785 9:16348556-16348578 GGACCCACCCCTGGAACTGGGGG - Intergenic
1059711825 9:116874697-116874719 GCACTCACCCCTGGAGTTGGAGG + Intronic
1060048330 9:120358684-120358706 GCAAGCGCCCCTGGAGCTGCAGG - Intergenic
1060204342 9:121673881-121673903 GGAGTCACCCATGGAGCTGATGG - Intronic
1062028778 9:134352628-134352650 GCCAGCACCCCGGGAGCTGCAGG - Intronic
1187398226 X:18936285-18936307 TCCTGCACTCCTGGAGCTGAGGG - Intronic
1189940578 X:46117136-46117158 GCAAGCACCCCTGAATCTGCTGG - Intergenic
1192847945 X:74925186-74925208 GCACGGACCCTTGGAGCAGCCGG - Exonic