ID: 1179631809

View in Genome Browser
Species Human (GRCh38)
Location 21:42683552-42683574
Sequence GGCAGCCCAGGCGGCCCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 534
Summary {0: 1, 1: 1, 2: 10, 3: 54, 4: 468}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179631809_1179631818 12 Left 1179631809 21:42683552-42683574 CCTCCGGGGCCGCCTGGGCTGCC 0: 1
1: 1
2: 10
3: 54
4: 468
Right 1179631818 21:42683587-42683609 CTGGCCCCATGCTCCTGAGATGG 0: 1
1: 1
2: 1
3: 17
4: 218
1179631809_1179631814 -7 Left 1179631809 21:42683552-42683574 CCTCCGGGGCCGCCTGGGCTGCC 0: 1
1: 1
2: 10
3: 54
4: 468
Right 1179631814 21:42683568-42683590 GGCTGCCTGGCCTCACGACCTGG 0: 1
1: 0
2: 1
3: 15
4: 163
1179631809_1179631822 24 Left 1179631809 21:42683552-42683574 CCTCCGGGGCCGCCTGGGCTGCC 0: 1
1: 1
2: 10
3: 54
4: 468
Right 1179631822 21:42683599-42683621 TCCTGAGATGGAGAAGCCCCAGG 0: 1
1: 1
2: 9
3: 40
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179631809 Original CRISPR GGCAGCCCAGGCGGCCCCGG AGG (reversed) Intronic
900126709 1:1072008-1072030 AGCGGGCCAGGCGGCCCCGGCGG + Exonic
900166384 1:1245737-1245759 CTCAGCCCACGCGGCCCCGCTGG - Intronic
900265532 1:1755428-1755450 GGAAGCCCAGGGAGCCCAGGTGG + Exonic
900307743 1:2019354-2019376 GGCCGCACAGGCGGCACAGGCGG - Exonic
900415560 1:2532928-2532950 GGCAGCTCTGGCGGCCTCCGAGG + Intergenic
900497535 1:2982826-2982848 GGCATCCCAGGCCGCCCCTCTGG - Intergenic
900600216 1:3499643-3499665 GGCATCACAGGCAGCTCCGGCGG + Exonic
900698379 1:4027153-4027175 GGCAGCCACGGCGGCACCAGCGG - Intergenic
901061275 1:6473097-6473119 GGCTGCCCAGGCTGCCCCGGGGG - Exonic
901109505 1:6784497-6784519 GCCAGCCCCGGCCGCCCGGGTGG - Intergenic
901239751 1:7686084-7686106 GGAAGACCAGGCAGCCCAGGTGG - Intronic
901297309 1:8170422-8170444 GGCAGGCCAGGAGGCCCAGAGGG + Intergenic
902371070 1:16007077-16007099 GGCAGCCCAGGTGGGACCTGGGG + Exonic
903828642 1:26161946-26161968 GACAGCCCGGGCGGCGCGGGCGG + Exonic
904037650 1:27567495-27567517 GGCAGCCAAGGTGTCTCCGGTGG - Intronic
904822785 1:33256323-33256345 CGCAGCCCGTCCGGCCCCGGGGG - Intergenic
905168683 1:36098101-36098123 GGGGGCCCGGGAGGCCCCGGAGG + Exonic
905734344 1:40315609-40315631 GGCACTCCCGGCGGTCCCGGGGG + Exonic
905734623 1:40316820-40316842 GGCAGCCCGGGGAGCCCAGGTGG - Intronic
905789896 1:40784222-40784244 GGCTGCCCAGGAGGCCGAGGCGG - Exonic
906477715 1:46181041-46181063 GCCAGCCCAGGTGGGCCCAGGGG + Intronic
907884043 1:58577005-58577027 TGCAGCCCCGACGGCCCCGGCGG - Exonic
908355634 1:63323197-63323219 CGCAGCTCCGGCGGCCCCGCGGG - Exonic
908476370 1:64492687-64492709 GGAAGCCCAGGCAGTCCCAGTGG - Intronic
908534792 1:65067265-65067287 GGCGGGCCAGGCGGCGCCGGGGG - Intergenic
908682880 1:66682132-66682154 GGAGGCCCAGGAGGCCCTGGGGG - Exonic
910145651 1:84077839-84077861 GCCAGCCCGGGCGACCGCGGGGG + Intergenic
910251352 1:85201447-85201469 GGCACCCCAGGCGTCTCCCGCGG + Intergenic
911052326 1:93681534-93681556 GGAGGCCCAGGCGCCCCGGGAGG + Intronic
911098260 1:94073359-94073381 TGAAGTCCTGGCGGCCCCGGAGG + Intronic
914263345 1:146018211-146018233 GGCAGCTCAGGCAGCACTGGAGG - Exonic
914286162 1:146228808-146228830 ATCTGCCCAGGCGGCCGCGGCGG - Exonic
914918375 1:151831790-151831812 GGCTGCCCTGGCTGCCCAGGAGG + Exonic
915231933 1:154452106-154452128 GGCAGCCCAGGAAGCCCTGCTGG - Intronic
915266643 1:154723097-154723119 GGCAGGCCAGGCATCCCCAGGGG + Intronic
915511372 1:156388656-156388678 GGAAGCCCAGGCGGCGGCGAAGG - Intergenic
915724565 1:158008285-158008307 GGCTGCCCAGCAGGCCCCAGGGG + Intronic
916108708 1:161448107-161448129 GGGGGCCCAGGAGGCCCAGGGGG + Intergenic
916110296 1:161455488-161455510 GGGGGCCCAGGAGGCCCAGGGGG + Intergenic
916111881 1:161462898-161462920 GGGGGCCCAGGAGGCCCAGGGGG + Intergenic
916113468 1:161470279-161470301 GGGGGCCCAGGAGGCCCAGGGGG + Intergenic
916666953 1:166975409-166975431 GGCCGCGCAGGCGGGGCCGGGGG + Intronic
920002779 1:202811066-202811088 TGCAGCCCAGGCGGCCGGAGCGG + Intergenic
920878417 1:209858724-209858746 GGCAGCGCAGGAGCCCACGGCGG + Intergenic
921039536 1:211416661-211416683 GGCAGCAGCGGCGGCGCCGGGGG + Intergenic
922782535 1:228264315-228264337 GGCAGGCCAGGCGGACGCCGGGG + Exonic
922783557 1:228272145-228272167 GGCAGGCCAGGCGGACGCCGGGG + Exonic
922933764 1:229408903-229408925 GGCAGCCCAGGCGGGCCCATGGG - Intergenic
923191753 1:231626828-231626850 GGCAGCCCAGGCGGAGCGGGAGG + Exonic
924257524 1:242197154-242197176 GGCAGCTCAGCCAGCCCAGGAGG + Intronic
924754976 1:246932239-246932261 AGCCGCCCTGGCGGCCCCGGCGG + Intergenic
1066022706 10:31319339-31319361 GGCAGCCGGGGCGCCCCCGGGGG + Intronic
1066746410 10:38606210-38606232 GGCAGCCCATCTGGCCTCGGAGG + Intergenic
1068953905 10:62804978-62805000 GGCAGCCGTGGCGGCCGCCGGGG + Exonic
1069386033 10:67884471-67884493 GGAAGCGCACTCGGCCCCGGCGG - Intergenic
1069438541 10:68407321-68407343 GGGCGCCCGGGCGGCCCCAGGGG + Intergenic
1069581968 10:69572544-69572566 GGCAGCCCAGGCGGTTCCCCCGG - Exonic
1069909496 10:71750808-71750830 GGGAGCCAAGGCGGCCACGGGGG + Exonic
1070564056 10:77590356-77590378 GGCAGCACAGGAGCCCACGGAGG + Intronic
1070783855 10:79151963-79151985 AGCAGCCCAGGGGGCCCAGATGG - Intronic
1071041049 10:81309150-81309172 GGCAGCACAGGAGCCCACGGAGG + Intergenic
1071794521 10:88990769-88990791 GCCAGCCCTGGCTGCCCAGGCGG + Exonic
1071963741 10:90832250-90832272 GGCAGTGCAGGAGGCCACGGTGG + Intronic
1072120942 10:92405229-92405251 GGCAGCCCAGGCAGAACAGGAGG - Intergenic
1073122616 10:101131770-101131792 GGAGGTCCCGGCGGCCCCGGAGG + Exonic
1073266368 10:102230676-102230698 GGCAGCCGCGGCGGCGGCGGCGG + Exonic
1073292798 10:102421595-102421617 GGCAGCCCCGGCGGCCCAAGGGG - Intronic
1073509769 10:104035512-104035534 GGCAAGCCAGGGGGCCCCGGGGG + Exonic
1073510269 10:104038465-104038487 GGAGGCCCAGGGGGCCCAGGGGG + Exonic
1073510273 10:104038474-104038496 GGGGGCCCAGGGGGCCCTGGCGG + Exonic
1074311561 10:112327319-112327341 GGGAGCCCAGGGGGCTCCTGTGG + Intergenic
1074421161 10:113309761-113309783 GGCAGACCAGTGGGCCCCTGGGG + Intergenic
1075070876 10:119319205-119319227 GGCAGCCGAGGGGGCCCCCAGGG + Intronic
1075405948 10:122195869-122195891 GGCTGGCCAGGGGGCCCAGGTGG + Intronic
1075419725 10:122291828-122291850 GGCAGCCCAGGTGGGCCAGCGGG - Intronic
1075519710 10:123136263-123136285 GGCGGCCAAGGGGGCCCTGGAGG + Exonic
1075534250 10:123256773-123256795 GGGAGCCCAGCCGGCACCTGGGG - Intergenic
1075885542 10:125896353-125896375 GGCGGCCCCCGCGGCCCCGCAGG - Intronic
1076566740 10:131404203-131404225 GTCAGCCCGGGAGTCCCCGGGGG - Intergenic
1076793441 10:132788071-132788093 GGCAGCCCAGGGAGGACCGGGGG - Intergenic
1077174332 11:1181748-1181770 GGCAGCCCAGGCTGGCCCCGGGG + Intronic
1077253580 11:1571316-1571338 GGGTGCCCAGCCGGCCCCTGAGG - Intronic
1077505671 11:2928978-2929000 GGCAGCCACGGCGTCCTCGGCGG + Exonic
1077610387 11:3640200-3640222 GGCAGCCCAGGAGACCTGGGAGG - Exonic
1078102597 11:8338558-8338580 GGCAGCCCTGGGGTCCCCAGAGG - Intergenic
1078507833 11:11965606-11965628 TGGAGCCCAGGCTGCCCAGGAGG - Intronic
1078619511 11:12893990-12894012 GGCTGCCCAGCCTGCCCTGGGGG + Intronic
1078822028 11:14892066-14892088 GGCAGCCCCGGCGGCCCCGGGGG + Exonic
1080628359 11:34051626-34051648 GGCAGCCCGAGCGGCCGCGAAGG + Intergenic
1082698720 11:56401995-56402017 GGCAGCACAGGAGCCCACGGAGG + Intergenic
1082928945 11:58579341-58579363 GGCGGCCAAGGCGGCTCCGGAGG + Exonic
1083440358 11:62672079-62672101 GGCGGCGAAGGCGGCGCCGGCGG + Exonic
1083888716 11:65585255-65585277 CGCAGACGGGGCGGCCCCGGGGG + Exonic
1083940129 11:65891237-65891259 GGCGGCCCCAGCGGCGCCGGGGG + Exonic
1083960344 11:66011866-66011888 GGGAGCCCAGGAGGCCGAGGGGG - Exonic
1084171039 11:67401275-67401297 GGAGGCCTAGGCGCCCCCGGAGG - Intronic
1084399587 11:68935966-68935988 CACACCCCAGGCGGCCCCTGAGG + Intronic
1084700819 11:70785218-70785240 GGGGGCCCAGGCGCCCCCAGGGG - Intronic
1084979583 11:72822047-72822069 GGCAGCCCTGGAGGCCCGCGTGG + Exonic
1085469059 11:76745222-76745244 GGTGGCCCAGGAGGCCCAGGAGG - Intergenic
1087761914 11:102110965-102110987 GGCGACCCAGGCGGCGCCGCAGG + Exonic
1088579445 11:111300594-111300616 GGCACACCAGGCGGCCTCCGGGG + Exonic
1089563338 11:119356993-119357015 GGCAGGCCGGCCGGCCTCGGGGG - Intronic
1090194146 11:124800434-124800456 GGCAGCCCCGGAGACCGCGGTGG - Exonic
1091284461 11:134400278-134400300 GTAAGACCAGGCGCCCCCGGAGG - Intronic
1091550291 12:1530989-1531011 GGCAGCCGGGGCGGCGGCGGCGG - Intronic
1092282342 12:7108056-7108078 GGCAGCCCCGGAGGCGCTGGTGG + Intronic
1093034539 12:14320379-14320401 GGCTGCCCAGGAGCCCACGGAGG - Intergenic
1093465068 12:19440195-19440217 GGCAGCCAGGGCGGCGGCGGGGG + Exonic
1094041115 12:26122631-26122653 GGCAGCGGCGGCGGCCCGGGGGG - Exonic
1096111558 12:49031927-49031949 GGCAGCCCAGGAGGCCCTGGAGG + Exonic
1096714496 12:53482959-53482981 GGAAGCCCAGGGGGCCTAGGAGG - Exonic
1097264117 12:57736209-57736231 GGGAGCGGAGGCGGCCCCCGGGG - Intronic
1098925716 12:76348107-76348129 GGCACCCCAGGCAGCCTCTGTGG - Intronic
1100391308 12:94148356-94148378 GGCGGCCGCGGCGGCCGCGGCGG + Intergenic
1102457188 12:113077996-113078018 CGGAGCCCGGGCGCCCCCGGCGG + Exonic
1103036943 12:117664413-117664435 GCCAGCCAAGGGGGCCCCTGGGG - Intronic
1103120175 12:118373194-118373216 CGCACCCCAGGCGGGCCCGTAGG - Intergenic
1103527798 12:121579361-121579383 AGCAGCCCCAGCGGCCGCGGCGG + Intronic
1104638272 12:130451160-130451182 GGCAGCCCCGGCAGCCCCTGCGG + Intronic
1104880368 12:132066824-132066846 GGCACCCCAGCCAGCCCAGGTGG + Exonic
1104891866 12:132144072-132144094 GGCGGCCCCGGCGGCGGCGGCGG - Exonic
1104966099 12:132509422-132509444 GTCAGCCCTGCCGGCCCCAGCGG + Intronic
1104966206 12:132509779-132509801 GACAGCGCAGCCGGCCCCTGTGG + Intronic
1104966259 12:132509962-132509984 GCCAGCCCAGCCGCCCCCGGCGG + Intronic
1105296386 13:19090757-19090779 GTCAGTCCACGGGGCCCCGGGGG - Intergenic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1105946582 13:25195713-25195735 GGAAGCCCAGGCTGCCCATGAGG + Intergenic
1106036860 13:26051565-26051587 GGCTGCCCGGGCGGCCCGGCCGG - Intergenic
1106157386 13:27171448-27171470 GGCGGCCCGGGCGGCCCGGGCGG - Intronic
1106226899 13:27792898-27792920 GGCAGCGCGGGCGGCCCGGGGGG - Exonic
1106256833 13:28029955-28029977 GGCAGCCCGGGCAGCCACAGGGG + Intronic
1106308298 13:28532500-28532522 GGCCGCCCAGACGCCCCCGGGGG - Intergenic
1106720150 13:32427990-32428012 GGCCGCCCCGGCCGCCCCCGCGG - Exonic
1107851412 13:44576559-44576581 GGCGGCGGCGGCGGCCCCGGGGG - Exonic
1108525307 13:51281030-51281052 GGAAGCCCAGGAGGCCTCTGTGG - Exonic
1108603651 13:52016456-52016478 GGCAGGCCTGGAGGCCCAGGAGG + Intronic
1110705951 13:78602202-78602224 GGCGGCCCGGGCGGCGGCGGCGG - Exonic
1112344419 13:98577460-98577482 GCCAGCCCACCCCGCCCCGGCGG + Intronic
1113420858 13:110170549-110170571 GGCAGGCCAGGCTGGCCCTGAGG + Exonic
1113653353 13:112053676-112053698 GGCACCGGAGGCGGCCCCTGGGG - Intergenic
1113655814 13:112067359-112067381 CGCAGCCCAGGCGCCCTCGGCGG - Intergenic
1113766053 13:112881754-112881776 GTCACCCCAGGCAGCCCCGTGGG + Intronic
1113960235 13:114122123-114122145 GGCTGCGCAGCCGGCCACGGCGG + Intronic
1114219564 14:20684422-20684444 GGCTGCCCCTGCGGCCCCTGGGG + Exonic
1116653768 14:47626658-47626680 GCCAGCCCCGTCGGCCCGGGCGG + Intronic
1117549102 14:56816769-56816791 GGCAGCCCCGGCGCCTCCAGCGG - Intergenic
1118762863 14:68891102-68891124 GGCAGCCCAGGGGGTCATGGAGG - Intronic
1119190661 14:72679830-72679852 GGCAGCCCAGGCCGGCCAGGCGG + Intronic
1120439070 14:84512984-84513006 GGCAGCACAGGGGCCCACGGAGG + Intergenic
1120993274 14:90397081-90397103 GGCGGCGCAGGCGGCGGCGGCGG + Exonic
1121220531 14:92281488-92281510 TTCAGCCCAGGCTGCCCCTGAGG - Intergenic
1121803915 14:96797678-96797700 GCCAGTCCAGGCATCCCCGGGGG - Intronic
1122130879 14:99604112-99604134 GGGCTCCCGGGCGGCCCCGGCGG - Intergenic
1122444993 14:101761701-101761723 GGCAGCCACGGCGGCGGCGGCGG - Intergenic
1122471274 14:101968370-101968392 GGGAGCCCAGGAGGCCGAGGTGG - Intronic
1122558298 14:102592975-102592997 GGCGGCCGAGGCGGCGGCGGAGG - Exonic
1122883816 14:104701776-104701798 GGCCGCCCAGGCGGACGCTGGGG + Intronic
1122922828 14:104886993-104887015 GACGGCCCTGGCGGCCCTGGAGG + Exonic
1202853551 14_GL000225v1_random:36578-36600 GCCAGCTCAGGCAGCACCGGAGG + Intergenic
1202872524 14_GL000225v1_random:177587-177609 GGCGGCCCCCGCGGCCCCGCAGG + Intergenic
1123941881 15:25220717-25220739 GGCAGCCCAGGCTCCCCTTGCGG + Intergenic
1123947448 15:25245697-25245719 GGCAGCCCAGGCTACCTCTGCGG + Intergenic
1123987565 15:25658768-25658790 GACAGCCCTGGCGGACGCGGGGG + Intergenic
1125033170 15:35093135-35093157 GGTGGCCCAGGCGGCGGCGGCGG + Intergenic
1125589354 15:40844666-40844688 GGCAGCCCAGGGGGCGCGGGCGG - Exonic
1125724030 15:41859015-41859037 GGCACCCCACCTGGCCCCGGGGG - Intronic
1126134684 15:45378598-45378620 GGCAGCCAATGGGGCCGCGGGGG - Exonic
1126145148 15:45466859-45466881 GGCAGCCCAGTGAGCCCCGCTGG + Intergenic
1127117395 15:55742441-55742463 TGCAGCCGCGGCGGCCCCGGCGG + Intronic
1127606479 15:60592349-60592371 GCCAGCCCACCCGGCCCCGGCGG + Intronic
1129664730 15:77573224-77573246 GGAAGGGCAGGCGGCCCAGGTGG + Intergenic
1129676040 15:77632813-77632835 GACAGCGCAGGCGGCGGCGGCGG - Intronic
1131032471 15:89197719-89197741 GGCAGTCCTGGTGGCCCCTGTGG + Exonic
1131036601 15:89226599-89226621 GAGAGCCCAGGCTGCCCCGTGGG + Intergenic
1132519792 16:381871-381893 GGCTGCCCGGGCGGCGGCGGGGG - Exonic
1132525756 16:413740-413762 GGCAGCCATGGGGGCCCTGGTGG - Intergenic
1132584596 16:700731-700753 GGAGGCCCAGGCGTCCCTGGCGG - Intronic
1132631313 16:918992-919014 TCCAGCCCAGGAGGCCCCGTGGG - Intronic
1132642968 16:986213-986235 GGCCGCCCTGGAGGGCCCGGAGG + Exonic
1132662113 16:1066203-1066225 GGGAGCCCGGGCCGCCCTGGGGG + Intergenic
1132750989 16:1457631-1457653 GGCGGCCCTCGCGGGCCCGGCGG + Intronic
1132932235 16:2464564-2464586 GCCAGCCAGGGCGGCCCCTGCGG - Exonic
1133281519 16:4668186-4668208 GCCAACCCAGGCGGCCACGCAGG + Intronic
1133367494 16:5222085-5222107 GGCAGCGCAGGAGCCCACGGCGG + Intergenic
1133972887 16:10580118-10580140 CGCAGCCCAGGAGGACCCGCTGG + Intronic
1135280894 16:21152883-21152905 GGCAGCACAGGAGCCCACGGAGG - Intronic
1136171981 16:28495224-28495246 GGAAGCCCAGGAGGACCTGGAGG + Exonic
1137286202 16:47017775-47017797 GGCAGCTCAGATGGCCCAGGTGG + Intergenic
1137590163 16:49688503-49688525 GGCAGCCCGGGCGGCTCCCCCGG + Intronic
1137655229 16:50153435-50153457 GGGAGCCCGGCCGGCGCCGGCGG - Intronic
1137655314 16:50153811-50153833 AGCAGCACCGGCAGCCCCGGCGG + Exonic
1138105135 16:54284032-54284054 GGCACCCCAGGCGCGGCCGGAGG - Intronic
1138595261 16:58026205-58026227 GGCGACCTAGGCGGCTCCGGCGG + Exonic
1140248344 16:73271417-73271439 GAAAGCCCAGGCTGCTCCGGAGG + Intergenic
1141079174 16:81035864-81035886 GGGAGCCATGGCGGCCTCGGAGG + Exonic
1141934372 16:87227603-87227625 GGCAGAGCAGGAGGCCCTGGGGG - Intronic
1142139404 16:88466047-88466069 GGGAGCCCAGGCGGCTCCACAGG - Intronic
1142156272 16:88534116-88534138 GCCGGCCCAGGGGGTCCCGGGGG - Exonic
1142163332 16:88570623-88570645 GGCCGCCGAGGCGGCGGCGGCGG + Intronic
1142170138 16:88617570-88617592 GGCAGCCCAGACAGCTCCTGCGG - Intronic
1142539118 17:643853-643875 GTCAACCCAGGAGGCCCAGGAGG + Intronic
1142686717 17:1581383-1581405 AGCAGCCCAGGAGGCCAGGGAGG + Intronic
1143058022 17:4176929-4176951 GGCAGCCCACGCAGCCCAGTGGG + Intronic
1143283401 17:5771502-5771524 GGCAGCGCAGGAGCCCACGGAGG - Intergenic
1143393462 17:6574285-6574307 GGCAGCCCAGGCGGACCAGCTGG + Intergenic
1143708612 17:8718152-8718174 GGCCGCACAGGCGCCCACGGTGG + Intergenic
1143962129 17:10729762-10729784 TGCAGGTCAGGCGGCCGCGGTGG - Exonic
1144840756 17:18184196-18184218 GGCTGCCCCGCCCGCCCCGGAGG + Intronic
1145158297 17:20557201-20557223 GGCACCTCAGGAGGCCCAGGCGG - Intergenic
1145904805 17:28510214-28510236 GGGAGCCCTGAAGGCCCCGGAGG - Intronic
1147658332 17:42103741-42103763 GGCGGCCCAGGCAGCCCAGCGGG - Exonic
1147969166 17:44210536-44210558 AGCAGCCCAGGCGCTCCCGCCGG + Intronic
1148021801 17:44558220-44558242 GGCACCCCGGGTGGCCCGGGCGG + Exonic
1148090261 17:45019098-45019120 GGCGGCGCGGGCGGCCCGGGCGG + Intergenic
1148371053 17:47100156-47100178 GGCAGAGGAGGCGGCCCCGAGGG - Intergenic
1149634666 17:58157085-58157107 GGACGCCGAGGCGGCCGCGGAGG + Intergenic
1150010177 17:61495726-61495748 TACAGCTCAGGCGGCCACGGAGG + Intergenic
1150358321 17:64506774-64506796 GGCAGCCCGGGCGGGTCCCGGGG - Exonic
1151496905 17:74463347-74463369 AACAGCCCAGGCTGCCCTGGCGG + Intergenic
1151702100 17:75748939-75748961 GGCGGACCTGGCGGCCCCGCAGG - Exonic
1151745079 17:76007606-76007628 GGAGGCCCAGGCGGCCACAGGGG - Exonic
1151876629 17:76870685-76870707 GGCAGCCCAGGGAGACCCTGGGG - Intronic
1151906985 17:77055087-77055109 GGCAATCCAGGCGGCCACGGGGG - Intergenic
1152611064 17:81315223-81315245 GGCTGCCCAGCTGGCCCCAGGGG + Intronic
1152701528 17:81822165-81822187 GGCTGCCCAGGGGGCCGCAGAGG - Intergenic
1152730367 17:81967020-81967042 GGCAGCCCAGGTGGCCAGGCGGG - Intergenic
1153900612 18:9614501-9614523 GGCTCCCCGGGCGGCCGCGGAGG - Exonic
1154402780 18:14057360-14057382 GGCAGCCCATGAGGCCCAAGGGG - Intergenic
1155208007 18:23577704-23577726 GGCTGCACAGGAGGCCACGGAGG + Intronic
1157359558 18:46964763-46964785 GGCAGCCCAGGGGCCCAGGGGGG - Intronic
1157361152 18:47024282-47024304 GGCAGCCCAGGGGCCCAGGGGGG - Intronic
1157362142 18:47030197-47030219 GGCAGCCCAGGGGCCCAGGGGGG - Intronic
1157591038 18:48836581-48836603 GGCAGTCCAGGGGGACCTGGTGG - Intronic
1158718451 18:59900635-59900657 GGGAGTCCAGGCGGTCCCCGGGG - Intronic
1160005054 18:75063406-75063428 GGCCGGCCAGGTGGCCCGGGTGG + Exonic
1160148710 18:76384025-76384047 GGCCTCCCAGGCGGCCCAAGGGG + Intronic
1160529525 18:79555372-79555394 GGGAGCCCTGGGTGCCCCGGGGG + Intergenic
1160826173 19:1081543-1081565 GGCAGGCCAGGCAGCACTGGGGG - Exonic
1160930701 19:1568305-1568327 GGCGGCCGAGGCGGCGGCGGCGG + Intergenic
1161069069 19:2251502-2251524 CTCTGCCCAGGTGGCCCCGGCGG + Exonic
1161114598 19:2489421-2489443 GGCAGGTCAGGCGGCTCCGCCGG - Intergenic
1161128822 19:2576249-2576271 TGCAGCCCGGACGGCCCCAGGGG + Intronic
1161282555 19:3453829-3453851 GCCAGCCGTGGCAGCCCCGGGGG - Exonic
1162039298 19:7960177-7960199 GGCAGCCCAGGGGTCCCTGCTGG - Exonic
1162042166 19:7977609-7977631 AGCAGCCCAGGCAGCCACAGTGG - Intronic
1162744170 19:12789797-12789819 GGCGGCCGTGGGGGCCCCGGGGG + Intronic
1162744818 19:12792352-12792374 GGCAGCCCCGGCGCCTCCCGAGG - Exonic
1163013745 19:14441190-14441212 GGCAGACCTGGCGGCCCCCGGGG + Exonic
1163426889 19:17245183-17245205 GGCGGCTGGGGCGGCCCCGGCGG - Exonic
1163438466 19:17309623-17309645 GGCGGCCGAGGCGGCGACGGAGG + Exonic
1163513131 19:17747883-17747905 TGCAGCCCCGGCGGCTGCGGAGG + Intronic
1163637211 19:18442637-18442659 GGCAGCCCAGGCTGCCTGGCTGG - Intergenic
1163708613 19:18832354-18832376 GGCGGCCCCGGCGGCCCGGGCGG + Exonic
1164617270 19:29674645-29674667 GGCAGACCAGGCCACCCCCGAGG - Exonic
1164641708 19:29831150-29831172 GGAAGCCCTGGAGTCCCCGGAGG + Intergenic
1164682729 19:30146310-30146332 GGCTGCCCTGGCTGCCCTGGTGG - Intergenic
1164733554 19:30523861-30523883 GGCATCCCAGCCGGGCCTGGTGG + Intronic
1164904876 19:31959243-31959265 GGCTGCCCAGGAGGAGCCGGAGG + Intergenic
1165392977 19:35548946-35548968 GGCAGGCCAGGCGGCTCCTCTGG - Intergenic
1165411512 19:35665322-35665344 GGCAGCATCGGCGGCCCCTGGGG + Intergenic
1165432085 19:35778576-35778598 GGCAGCCCTGGCACCCTCGGGGG - Exonic
1165961638 19:39539842-39539864 GGCAGCCAGGGGAGCCCCGGTGG - Exonic
1165961648 19:39539866-39539888 GGCGGCCAGGGCAGCCCCGGCGG - Exonic
1166358610 19:42242323-42242345 TCCGGCCCAGGCGGCACCGGCGG - Exonic
1166682617 19:44778124-44778146 GCCGGCGGAGGCGGCCCCGGGGG + Exonic
1166682620 19:44778133-44778155 GGCGGCCCCGGGGGTCCCGGCGG + Exonic
1166689406 19:44813574-44813596 GGCTGTCCAGGCGGCCGTGGCGG - Exonic
1166754074 19:45179737-45179759 GGCAGCCCAGGCGGCGGGGCTGG + Exonic
1167269933 19:48500961-48500983 GGCAGGCCAGGAGCCCCGGGTGG + Intronic
1167309586 19:48729259-48729281 GGCAGCCACGGCGGCCTCGCAGG + Exonic
1167331603 19:48859625-48859647 GAGGGCCCCGGCGGCCCCGGTGG - Exonic
1167369596 19:49072651-49072673 GGCGGCCGAGGCGGCCGAGGCGG - Exonic
1167645317 19:50702584-50702606 GGCTGCCCAGGGAGCCCCCGGGG + Exonic
1167645320 19:50702598-50702620 GGGGGCTCAGGGGGCCCCGGGGG - Exonic
1168401548 19:56088382-56088404 GGCAGCCATGGCGGGCGCGGGGG - Exonic
1168414453 19:56159704-56159726 GGCAGGCCAGGCGCCAGCGGGGG - Exonic
1168432021 19:56288834-56288856 GGCAGCCCAGGTTGCAACGGAGG - Intronic
925284585 2:2707385-2707407 GGGAGCCCAGGCGGCTCAGCAGG + Intergenic
927171656 2:20375362-20375384 GGCAGCCCAGGGGATGCCGGTGG + Intergenic
927177301 2:20419698-20419720 GGCAGCCCAGGGGATGCCGGTGG + Intergenic
927209073 2:20627694-20627716 GGCAGCCCAGGCAGCATGGGTGG - Intronic
927508110 2:23627605-23627627 GGCAGCACACACGGCCTCGGAGG - Intronic
927713821 2:25340920-25340942 GGGTGCCCGGGCGGCCGCGGTGG - Intronic
927937613 2:27084435-27084457 TGCAGCCCAGGAGGCCCTGGGGG - Exonic
929829239 2:45334170-45334192 GGCAGCCCAGGGTGCACCAGAGG - Intergenic
932714522 2:74091631-74091653 GGCAGCCCTGGCGACCCCACTGG + Intronic
934858202 2:97741886-97741908 GGCAGCCCACTGGGCCCTGGAGG + Intergenic
937259561 2:120576807-120576829 GGGAGCCCTGGCGGCCACCGAGG + Intergenic
939613008 2:144332519-144332541 GGCATCCGCGGCGGCCGCGGGGG - Intronic
941666378 2:168247348-168247370 GGCGGCGGCGGCGGCCCCGGCGG - Exonic
942450912 2:176107617-176107639 AGCAGCGGGGGCGGCCCCGGCGG + Exonic
942799681 2:179861234-179861256 TGCAGCCCAGGCGGTGGCGGTGG + Exonic
943081156 2:183260698-183260720 GGCACCCGAGGAGGCGCCGGAGG + Intergenic
943811485 2:192194620-192194642 GGCAGCAGAGGCGGCGGCGGTGG + Exonic
944158975 2:196639451-196639473 GGCAGCACAGGACCCCCCGGAGG + Intergenic
946321973 2:218959738-218959760 TGCAGCCCCGGGGGACCCGGCGG - Exonic
946921428 2:224585156-224585178 GGCAGCCGCGGCGGCGGCGGGGG + Exonic
948207005 2:236167775-236167797 GGCAGCGCGGGCGGCGGCGGCGG + Exonic
948988667 2:241541146-241541168 AGCAGCCCCGGCGCCCACGGAGG + Intergenic
949003019 2:241628211-241628233 GGCAGCCGAGGCGGGTCCAGGGG - Intronic
1168811934 20:710154-710176 AGCAGACCGGGCGGCCCGGGGGG - Intergenic
1169197314 20:3690193-3690215 GGCAATCCAGGATGCCCCGGAGG + Exonic
1169332138 20:4724488-4724510 GGGAGCCCAGGCAGGCCTGGTGG + Intronic
1169800340 20:9507094-9507116 GGGAGCCCAGGCGGCGGAGGCGG - Intergenic
1171446353 20:25207249-25207271 GGCAGCCCCGGGGGCCCGGTGGG + Exonic
1172474458 20:35226675-35226697 GGCGGCCGAGGCGGCGGCGGCGG + Exonic
1172752106 20:37258295-37258317 AGAAGCCCAGCCAGCCCCGGAGG + Intronic
1173800322 20:45891005-45891027 GGCAGGCCAGCTGGCGCCGGGGG + Exonic
1174607010 20:51768401-51768423 GGCGGCCCAGGCGGCGCGGGGGG - Exonic
1175366982 20:58462304-58462326 GGCAGCCCAGCCGGCCCTCTGGG - Intronic
1175771630 20:61627933-61627955 GGAAGGCCAGGGGGCCCAGGAGG - Intronic
1175997334 20:62817594-62817616 GGCTTCCCGGGCGGCCCTGGGGG - Exonic
1175998325 20:62821193-62821215 CCCAGCCCGGGCGGCCCCGGGGG - Exonic
1175999167 20:62824469-62824491 GGCATTCCAGGGGGCCCTGGGGG - Exonic
1176130392 20:63494395-63494417 GGCAGCCAAGGAGGCCCCCACGG + Intronic
1176132561 20:63502498-63502520 GGCCGTCCAGGGGGCCCAGGTGG - Intergenic
1178371773 21:32032624-32032646 GACAGCCCAGGAGCCCCTGGGGG + Intronic
1178753250 21:35324041-35324063 AGCAGCCCAGGCAGCCACGTGGG - Intronic
1178810551 21:35877450-35877472 AACAGCCCAGGCTGCCCAGGAGG + Intronic
1179631809 21:42683552-42683574 GGCAGCCCAGGCGGCCCCGGAGG - Intronic
1179712197 21:43269673-43269695 GGAAGCCCAGGAGGCTCCTGAGG - Intergenic
1180080843 21:45486945-45486967 GGGGGCCCAGGGGGCCCAGGGGG - Exonic
1180085260 21:45505375-45505397 GGGGGCCCAGGGGGGCCCGGAGG - Exonic
1180085265 21:45505384-45505406 GGGGGCCCAGGGGGCCCAGGGGG - Exonic
1180872189 22:19152551-19152573 GGCAGGCCAGGCAGGCACGGTGG - Intergenic
1180985095 22:19899380-19899402 CCTAGCCCAGGAGGCCCCGGGGG - Intronic
1181023758 22:20116516-20116538 TGCAGCCCCGGCAGCCCTGGAGG - Exonic
1181048884 22:20229407-20229429 GGAAGCCCAGACCGCCCCAGTGG - Intergenic
1181467586 22:23118484-23118506 GGCTGCCAAGGCAGCCGCGGGGG - Intronic
1182121615 22:27790858-27790880 CACAGCCCAGGAGGCCCGGGAGG + Intronic
1182237001 22:28883808-28883830 GGCGGCGCAGGCGGCGGCGGCGG - Exonic
1182586072 22:31345012-31345034 GGCTGCCAAGGCTGCCCCGTTGG + Exonic
1183259866 22:36787751-36787773 TGCATCCCAGGCGGCCCCGCAGG + Intergenic
1183427309 22:37746640-37746662 GGGAGCCCAGGCGACCCTGAGGG + Intronic
1183466707 22:37983799-37983821 GGCGGCCGAGGCGGCGGCGGCGG - Exonic
1183540520 22:38426941-38426963 GGCAGCTGCGGCGGCCGCGGTGG - Exonic
1183961474 22:41414047-41414069 GGCAGGCGAGGCGGCGCTGGAGG - Intergenic
1184109743 22:42387741-42387763 AGCAGCCCAGGTGGCCCAGGAGG - Intronic
1184371467 22:44084738-44084760 GGCAGCACTGGCTGCCTCGGGGG - Intronic
1184759600 22:46537142-46537164 GGCAGCACGGGCGGCGGCGGCGG + Exonic
1184769088 22:46587581-46587603 GGCAGCCCAGGCCGGGGCGGGGG + Intronic
1185015861 22:48342204-48342226 GGCAGCTGAGGCACCCCCGGGGG + Intergenic
1185279227 22:49962825-49962847 GGAAGAGCAGGCGGCCTCGGAGG - Exonic
1185331054 22:50252199-50252221 GGCAGGCCAGGTGTCCTCGGTGG - Intronic
1185388932 22:50548653-50548675 GGCAGCCCTGCCGGCCGCAGCGG + Exonic
1185420194 22:50730764-50730786 CGCAGCCCCGGGGGCCCGGGCGG + Intergenic
950436535 3:12983643-12983665 GTCAGCCCAGGCGTCCCTGAAGG - Intronic
950469035 3:13173387-13173409 TGCAGCCCGGGCTCCCCCGGGGG + Intergenic
950479481 3:13235646-13235668 GGGACCCCAGGTGGCCCGGGCGG + Intergenic
953979826 3:47408006-47408028 GGCAGCCCTGGGGCCCCCAGAGG - Intronic
954106750 3:48413722-48413744 GGCAGCCCAGGTGGGCTTGGGGG - Exonic
954134422 3:48575460-48575482 GCCAGACCAGGTGGCCCCTGAGG + Exonic
954882776 3:53846719-53846741 GCCAGTCCAGGCTGCCCCGAAGG + Intronic
957405146 3:79766589-79766611 GGCAGCCCAGGCTGCAGCAGTGG + Intronic
957995146 3:87679384-87679406 GGCAGCACAGGAGCCCACGGAGG - Intergenic
958891993 3:99794292-99794314 GGCAAACCAGGGGGCCCAGGTGG - Exonic
960996128 3:123341713-123341735 GACAGCCCAGGGGGCCCTGTTGG - Intronic
961305907 3:125959060-125959082 GTCAGCCCTGCCGGCCCCAGCGG + Intergenic
961305988 3:125959350-125959372 GACAGCGCAGCCGGCCCCTGTGG + Intergenic
961670248 3:128523590-128523612 GGCAGCGCAGGAGGCTCCTGGGG - Intergenic
962754651 3:138458425-138458447 AGCTGCCCAGGCAGCCCCCGGGG + Intronic
964138321 3:153369834-153369856 GGGAGCCCAGGGGGGCCGGGGGG + Intergenic
964478678 3:157120549-157120571 GGCAGGCCACGCGGCGCGGGCGG - Intergenic
965590410 3:170356924-170356946 GGGAGCAGAGCCGGCCCCGGGGG + Intergenic
966787575 3:183635482-183635504 GGAGCCCCAGGTGGCCCCGGAGG + Intergenic
967867774 3:194204273-194204295 AGCAGCCGACCCGGCCCCGGGGG + Intergenic
967973037 3:195013154-195013176 GGCATCCCAGGCAGTCCCCGGGG + Intergenic
968083336 3:195862486-195862508 GGAAGCCCAGCCGGGCGCGGTGG + Intergenic
968126445 3:196163874-196163896 TGCAACCCAGGCCGGCCCGGGGG - Intergenic
968547239 4:1205569-1205591 GGAAGGCCAGGCGGCTCCGATGG - Intronic
968820209 4:2844132-2844154 GGCGGCCCGGGCAGCCTCGGGGG + Intronic
968926068 4:3549116-3549138 GGCAGCCCAGGGTGCCCCAGTGG + Intergenic
969413468 4:7043952-7043974 CGCACCCCAGAAGGCCCCGGAGG + Intronic
970322214 4:14886085-14886107 TGCAGCCCAGGCCACCCCTGAGG - Intergenic
972396656 4:38664102-38664124 CCCAGCCCGGGCGGCCGCGGCGG + Intergenic
972765834 4:42151862-42151884 GGCGGCCCGGCCGGGCCCGGGGG + Exonic
975166900 4:71187303-71187325 GGCAGCGAAGGCGGCGGCGGCGG + Exonic
975605191 4:76148125-76148147 GGCACCCGAGGAGGCCACGGGGG - Intronic
976223961 4:82780801-82780823 GCCACCCCAGGAGGCCCCAGGGG + Intronic
980328426 4:131379382-131379404 GGGAGCCGAGGCTGCGCCGGTGG + Intergenic
981034216 4:140153143-140153165 GGCGGCTCCGGGGGCCCCGGCGG - Exonic
981617296 4:146655185-146655207 GCGAGTCCAGGCGGCCCCAGAGG - Intergenic
982068311 4:151673529-151673551 GGTAGGCCAGGGGGCCCCTGTGG - Intronic
984944920 4:184963210-184963232 GGCAGCCCATGCGGTCCCTCAGG + Intergenic
985129226 4:186724452-186724474 GGGAGGCCAGGCGCCCGCGGCGG - Intronic
985822137 5:2167640-2167662 GGCAGCACACACGGCCCCTGGGG - Intergenic
987099940 5:14582294-14582316 GGGAGCCCAGGCAGCGGCGGAGG + Intronic
987373795 5:17217132-17217154 GACAGCCCAGGCGGCGCGGCGGG + Intronic
991330196 5:65485547-65485569 GGCAGCACAGGAGCCCACGGAGG + Intergenic
992056594 5:72996870-72996892 GCCGGCCCCGCCGGCCCCGGGGG - Intronic
992269933 5:75053553-75053575 GGCTGCGGAGGCCGCCCCGGCGG + Intergenic
996900849 5:128539190-128539212 GGGAGCTCACGCGGCCGCGGGGG + Intronic
997626668 5:135335881-135335903 GGTAGCCCAGGGGACCCCGGAGG + Intronic
998130301 5:139648395-139648417 GGCAGCAGAGGCGGCACTGGCGG + Exonic
998148842 5:139745795-139745817 GGCAGGCCAGGCTGACCCTGAGG - Intergenic
998407683 5:141883219-141883241 GGCAGCCCCCGGGGACCCGGTGG + Intergenic
998562382 5:143183662-143183684 GGCGTCCGAGGAGGCCCCGGGGG - Intronic
999705874 5:154272135-154272157 GGCAGCCCTGGAGGCCAGGGCGG - Intronic
999767968 5:154755404-154755426 GGAAGCCCGGGCCGCCCCGGGGG + Intronic
1001118908 5:168962650-168962672 GCCAGCTCAGGCTGCCCTGGGGG - Intronic
1002058074 5:176610064-176610086 GGCAGCCGAGGCCGCTCGGGCGG - Exonic
1002302160 5:178263272-178263294 GGAGGTCCAGGGGGCCCCGGAGG + Exonic
1002927242 6:1611559-1611581 GGCAGCTCGGGCGGCGGCGGCGG + Exonic
1003227625 6:4220694-4220716 GGGAGGTCAGGTGGCCCCGGAGG + Intergenic
1005990166 6:30897544-30897566 GGCAGCCGAGGGGGCCCCTGGGG + Exonic
1006295188 6:33167107-33167129 GGCAGCCCTGGGGGTCCCTGTGG + Exonic
1006677741 6:35776522-35776544 GGCGCCCCAGGCCACCCCGGCGG - Intergenic
1006751503 6:36380832-36380854 GGCAGGCAAGGAGGCCCTGGGGG - Intronic
1007763839 6:44149805-44149827 GGCAGTCTAGGGGGCCCAGGTGG - Intronic
1009934391 6:70216970-70216992 GGAAGCCCAGGAGGTCCCGGGGG + Exonic
1012475779 6:99613755-99613777 GGCAGGCCAGGCGGCGGCGGCGG - Exonic
1013184308 6:107744823-107744845 GGCAGCCCATGGGGCTCCAGTGG + Intronic
1013619328 6:111873027-111873049 CGCGGCCGAGGCGGCTCCGGGGG + Exonic
1013963413 6:115928155-115928177 GGCAGCACAGGAGCCCACGGCGG + Intergenic
1015090628 6:129353183-129353205 GGCAGTCCAGGCAACCCTGGAGG + Exonic
1015625934 6:135181186-135181208 GGCAGCCAGGGCGACCGCGGAGG + Intergenic
1015776795 6:136822746-136822768 CGCAGGCCAGGCGGCCCGGCAGG - Exonic
1016010592 6:139134906-139134928 GGGAGTCCAGGAGGCCCGGGTGG + Intergenic
1017672222 6:156778653-156778675 GGCGGCCCCGGCGGCCGCGCTGG + Exonic
1017795482 6:157840308-157840330 GGAGGCCCAGGCGACCACGGGGG + Intronic
1017912787 6:158808644-158808666 GGCATCCCAGGCGGGCACGCAGG + Intronic
1018774218 6:166998871-166998893 TGCAGCCCCTGCAGCCCCGGGGG - Intergenic
1019322624 7:422541-422563 GTCAGACGATGCGGCCCCGGAGG - Intergenic
1019340116 7:504884-504906 GGGAGCCCACGCGCCCGCGGTGG - Intronic
1019360968 7:604036-604058 GGCAGCCCAGGCCTGCCCAGTGG - Intronic
1019371699 7:665380-665402 GGCAGCCTCGGGGGCCACGGGGG + Intronic
1019379345 7:712822-712844 AGCAGCTCAGGCAGCCGCGGTGG - Intronic
1019382412 7:730898-730920 GGCAGCACAGAGGGCCCCTGAGG + Intronic
1020252794 7:6483489-6483511 GGCAGCCCAGCCAGCTCGGGAGG - Intronic
1020260152 7:6526530-6526552 GGCGGCCTCGCCGGCCCCGGGGG - Exonic
1022427957 7:30285564-30285586 GGCGGCCCCGGCAGCCCCGGCGG + Exonic
1023396169 7:39754023-39754045 GGCTGCCCAGGAGCCCACGGCGG + Intergenic
1024465942 7:49711540-49711562 GGCAGCACAGGAGCCCACGGAGG - Intergenic
1026236898 7:68535059-68535081 GCCAGCACAGGAGGCCACGGTGG + Intergenic
1029424953 7:100489299-100489321 GGGAGGCCAGGCAGCCGCGGTGG - Exonic
1029506521 7:100966593-100966615 GGCAGCCAAGGGGTCCCAGGCGG + Intronic
1029597444 7:101545349-101545371 GGAAGCCCACGGGGCCCTGGAGG - Exonic
1029629908 7:101743789-101743811 GGCAGCGGGGACGGCCCCGGAGG + Intergenic
1029640432 7:101816462-101816484 GGCGGCCCCGGCGGCCCGCGGGG + Intronic
1031599745 7:123692519-123692541 GGCAGGCCAGGCGGGGGCGGTGG + Exonic
1032795191 7:135270790-135270812 GCCAGGCCAGGCGCCCCCGGAGG + Intergenic
1034257607 7:149733229-149733251 GGCAGCTCAGGCGGGCCCTGGGG - Exonic
1034469724 7:151248761-151248783 GGCAGCCGCGGCGGCGGCGGCGG - Exonic
1034977738 7:155457982-155458004 GGCGGCCCAGGCGGCGGCGCCGG + Intergenic
1035162989 7:156965098-156965120 GGCAGCGCAGGCGGCGAAGGCGG - Intronic
1035728268 8:1838143-1838165 GGCACCCCCGGCACCCCCGGTGG - Intronic
1036645202 8:10608250-10608272 GGCAGAAGAGGCGGCCCAGGAGG - Exonic
1036656554 8:10680902-10680924 GGCAGCCCAGGCAGGAGCGGGGG + Intronic
1036656969 8:10683099-10683121 GGCAGCCCAGGAGACCCCCATGG + Intronic
1036785018 8:11680254-11680276 GGGAGACCAGGCGGTGCCGGTGG + Intronic
1037134698 8:15446476-15446498 GGCACCTCAGGAGGCCCAGGCGG + Intronic
1039391022 8:37180831-37180853 GGCAGCCCAGGAGCCCCAGAGGG + Intergenic
1040495456 8:47961244-47961266 GGCAGACGGGGCGGCGCCGGGGG - Intronic
1042591777 8:70403664-70403686 GCCCGCCCTCGCGGCCCCGGGGG + Intronic
1043502790 8:80873805-80873827 GGCGGCGGCGGCGGCCCCGGTGG + Intronic
1045235678 8:100351005-100351027 GGCACCTCAGGAGGCCCAGGCGG - Intronic
1047100152 8:121667519-121667541 GGCTGCGCAGGAGCCCCCGGCGG + Intergenic
1049104622 8:140604087-140604109 TGCAGCCCCAGCAGCCCCGGAGG + Intronic
1049309064 8:141923783-141923805 GGCAGCCCAGGCTGGCCTGGTGG + Intergenic
1049399577 8:142418929-142418951 GGCAGCCCAGGCCTCCCCAGAGG + Intergenic
1049496786 8:142939310-142939332 GGCAGGCCAGGAGGCGCCGGCGG + Intergenic
1049522668 8:143102254-143102276 GGCACCCCAGGGGGCCCCTCAGG - Intergenic
1049707101 8:144048056-144048078 AGCAGCCCAGGCATCCCCGGAGG - Intergenic
1049788440 8:144462378-144462400 GGCGGCCGAGGCGGCGGCGGCGG - Intronic
1049788444 8:144462387-144462409 GGCAGCCGAGGCGGCCGAGGCGG - Intronic
1052192794 9:25678185-25678207 GGCAGCCCCAGCGGCGGCGGCGG - Exonic
1052494865 9:29213161-29213183 GGCAGCCAAGTTGGCCCAGGAGG - Intergenic
1052888873 9:33677133-33677155 GGCGCCCCCGGTGGCCCCGGCGG - Intergenic
1053312320 9:37027541-37027563 GGCAGCCCCGGCGGCCTTGGTGG - Intronic
1053312325 9:37027550-37027572 CTCAGCCCCGGCAGCCCCGGCGG - Intronic
1053800996 9:41764522-41764544 GGCAGCCCAGGGTGCCCCAGTGG + Intergenic
1054144201 9:61550315-61550337 GGCAGCCCAGGGTGCCCCAGTGG - Intergenic
1054189427 9:61976672-61976694 GGCAGCCCAGGGTGCCCCAGTGG + Intergenic
1054649088 9:67611937-67611959 GGCAGCCCAGGGTGCCCCAGTGG - Intergenic
1056799570 9:89681538-89681560 GGCAGCCCAGGAGCCCGTGGTGG - Intergenic
1056813488 9:89782510-89782532 GGCAGCCCAGAGGGGCCCAGGGG - Intergenic
1056936732 9:90920199-90920221 GGCAGCCAAGGCTGTCCAGGAGG - Intergenic
1057263344 9:93598420-93598442 GTCAGTCCATGGGGCCCCGGGGG + Intronic
1057463744 9:95292331-95292353 GGGAGCCATGGCGGCCTCGGAGG + Intronic
1057916104 9:99056356-99056378 GGTGGCCCCGGGGGCCCCGGTGG - Exonic
1059418762 9:114178285-114178307 GGTAGCCCAGGGGGACCCTGAGG - Exonic
1059418765 9:114178294-114178316 GGTAGCCCAGGTAGCCCAGGGGG - Exonic
1059449668 9:114362494-114362516 GGCTGCCCACGCGGCCCTAGAGG - Exonic
1060402316 9:123356090-123356112 AGCAGCCCAGGAGGCCTGGGTGG + Intergenic
1060549350 9:124477765-124477787 GCCCGCCCAGGCGCCCCCCGGGG + Intronic
1060700619 9:125746975-125746997 CCGAGCCCCGGCGGCCCCGGGGG - Intergenic
1060895123 9:127212255-127212277 GGAAGCCCCTGCTGCCCCGGTGG - Intronic
1061008716 9:127942928-127942950 GGCAGGCCAGGCAGGCCAGGCGG - Exonic
1061208097 9:129175960-129175982 TGGATCCCCGGCGGCCCCGGGGG - Exonic
1061808456 9:133149131-133149153 GGCTGCCGGGGCGGCCCCGAGGG - Intronic
1062109308 9:134773293-134773315 CGCAGCCCAGCAGGCCCCGCAGG - Intronic
1062118583 9:134822127-134822149 GGCAGGCCAGGGGGCCCAGGAGG - Exonic
1062147649 9:134998855-134998877 GGCAGACCAGGATGTCCCGGTGG + Intergenic
1062274577 9:135724760-135724782 GGCAGCCCAGCCGACCCAGCCGG - Intronic
1062289518 9:135788288-135788310 GTCAGCCCAGGCGGCCCTGTTGG + Intronic
1062340213 9:136090795-136090817 GGCTGCCCTCGGGGCCCCGGTGG + Intronic
1062491714 9:136808092-136808114 GGCGGCCCCGGCCCCCCCGGAGG - Exonic
1062546252 9:137064941-137064963 GGCAGGGCAGGGGGGCCCGGAGG + Exonic
1062579202 9:137222077-137222099 GGCAGCTCGGGGGGCTCCGGCGG + Intergenic
1062591953 9:137278301-137278323 GGCCGCCCAGGCGCCCACTGGGG - Intronic
1062689697 9:137834884-137834906 CGCGGCCCAGGAGGCCCAGGAGG + Exonic
1062708894 9:137960747-137960769 GGGACCCCAGGCCGCCCTGGTGG + Intronic
1203761017 EBV:13034-13056 GGCAGCCCGGGCGGCCCCAGAGG + Intergenic
1203761946 EBV:16106-16128 GGCAGCCCGGGCGGCCCCAGAGG + Intergenic
1203762875 EBV:19178-19200 GGCAGCCCGGGCGGCCCCAGAGG + Intergenic
1203763804 EBV:22250-22272 GGCAGCCCGGGCGGCCCCAGAGG + Intergenic
1203764733 EBV:25322-25344 GGCAGCCCGGGCGGCCCCAGAGG + Intergenic
1203765662 EBV:28394-28416 GGCAGCCCGGGCGGCCCCAGAGG + Intergenic
1203766591 EBV:31466-31488 GGCAGCCCGGGCGGCCCCAGAGG + Intergenic
1203767520 EBV:34538-34560 GGCAGCCCGGGCGGCCCCAGAGG + Intergenic
1203731930 Un_GL000216v2:98955-98977 GGCGGCCCCCGCGGCCCCGCAGG - Intergenic
1185465052 X:349490-349512 GGCCGTCCAGGCGGCCTTGGTGG - Intronic
1185836645 X:3350819-3350841 TGCAGCCCAGGAGACCCAGGAGG + Intergenic
1185877589 X:3713217-3713239 GCTGGCCCAGGCGGCCGCGGCGG - Exonic
1190285238 X:48957239-48957261 GGGGGCCCAGGTGGTCCCGGCGG - Exonic
1190333543 X:49249747-49249769 GGGAGCCAAGGCGGGCCGGGGGG + Intronic
1192437954 X:71154300-71154322 GGCAGCTCAGGGGGGCCCAGTGG + Intronic
1192438657 X:71158370-71158392 TGCAGCCCAGCCGGGCGCGGTGG - Intronic
1193198126 X:78657787-78657809 AGCAGCCCAGGAGTCCCTGGAGG - Exonic
1195259335 X:103117184-103117206 GGCAGCACAGGAGCCCACGGAGG + Intergenic
1195709082 X:107759870-107759892 GCCAGCCCAGGCTGGCCCTGAGG - Intronic
1195793320 X:108614940-108614962 GGCAGCCCAGGAGGTCCCATTGG - Exonic
1195909573 X:109875969-109875991 GGCAGCCCAGGAGCCCACGGAGG + Intergenic
1196871233 X:120115580-120115602 GCCGGCCCAGGCGGCCATGGAGG - Exonic
1197770097 X:130084213-130084235 GGCAGCTGAGGCTGGCCCGGAGG - Intronic
1198583684 X:138096179-138096201 GGCAGCCCTGGCCTCCCCAGTGG + Intergenic
1198807192 X:140504171-140504193 GGCAGCGCGGGCGGCGGCGGCGG + Exonic
1199500351 X:148500612-148500634 GGCTGCACAGGCGGCGGCGGCGG - Exonic
1199500371 X:148500678-148500700 GGCAGCCGGGGCGGCAGCGGCGG - Exonic
1199593789 X:149491349-149491371 GTCAGCCCAGGAGGGGCCGGTGG - Intronic
1200114193 X:153762961-153762983 GGCAGACCAGGCAGGCCCGTGGG - Intergenic
1200787718 Y:7274327-7274349 GCCGGCCCAGGCGGCCGCGGCGG + Intergenic
1201239970 Y:11949232-11949254 TGCAGCCCAGGAGACCCAGGAGG - Intergenic