ID: 1179634269

View in Genome Browser
Species Human (GRCh38)
Location 21:42697220-42697242
Sequence ACTTTGGGCCCTTTGTCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179634269_1179634275 1 Left 1179634269 21:42697220-42697242 CCTACAGACAAAGGGCCCAAAGT 0: 1
1: 0
2: 2
3: 9
4: 121
Right 1179634275 21:42697244-42697266 CAGGGAGGTCAGTGCCACACAGG 0: 1
1: 0
2: 0
3: 19
4: 241
1179634269_1179634277 23 Left 1179634269 21:42697220-42697242 CCTACAGACAAAGGGCCCAAAGT 0: 1
1: 0
2: 2
3: 9
4: 121
Right 1179634277 21:42697266-42697288 GTTTTATTTTTTCACATTATTGG 0: 1
1: 0
2: 10
3: 93
4: 1061

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179634269 Original CRISPR ACTTTGGGCCCTTTGTCTGT AGG (reversed) Intronic
900171649 1:1272231-1272253 GCTTGGTGTCCTTTGTCTGTGGG - Intronic
900428122 1:2589722-2589744 ACCTTGGGCCTTTGGCCTGTGGG + Exonic
901260323 1:7866134-7866156 GCTCTGGGCCCCTTGCCTGTGGG + Intergenic
903040426 1:20525560-20525582 ACTTTGACCCAGTTGTCTGTGGG + Intergenic
908405669 1:63811877-63811899 ACTTTGGGCTCTATGTCCTTAGG + Intronic
912197455 1:107415271-107415293 ACTATGGACCTTTTGACTGTTGG - Intronic
912404283 1:109423904-109423926 AGTTTGGGTCCTATTTCTGTAGG - Intronic
916737178 1:167618218-167618240 ACTTTGGCCCCTTTGCCTACAGG + Intergenic
919145630 1:193630817-193630839 ACTTTTGCCCCTTTTTCTATCGG - Intergenic
921348224 1:214208886-214208908 ACTTGGGTGCCTTTGTCTTTTGG + Intergenic
1063939435 10:11111730-11111752 ACTTGGGGCACTCTGCCTGTAGG - Intronic
1069965628 10:72112904-72112926 ACTTTGGGTCCATTGTATGTTGG - Intronic
1071685901 10:87756136-87756158 ACTCTTGTCCCTTTGTCTCTTGG - Intronic
1076177337 10:128378169-128378191 AGCTTGGGCTCTGTGTCTGTTGG + Intergenic
1076228757 10:128802649-128802671 ATTTTGGCCCCCTTCTCTGTAGG - Intergenic
1078565775 11:12412690-12412712 TCTTTTGTCCCTTTCTCTGTAGG - Intronic
1079080350 11:17409532-17409554 TCTTTGGGCCTTTTTTCTTTGGG + Intronic
1080088992 11:28321350-28321372 ACTTAGAGCCCTTTCTCTGAAGG + Intronic
1080201665 11:29678478-29678500 ACTTTGGACTCTTTGTGAGTAGG - Intergenic
1080276479 11:30508731-30508753 ACGTTTGGCCCTTTGTCTGTGGG - Intronic
1085629706 11:78104439-78104461 ATTTTTAGCCTTTTGTCTGTGGG - Exonic
1085870751 11:80346817-80346839 TCTGTGGGCCCTCTGTCTTTTGG + Intergenic
1086630833 11:89017838-89017860 ACTTATGACCCTTTCTCTGTAGG - Intronic
1089251840 11:117169123-117169145 AATTTTGGGCCTTTTTCTGTGGG + Exonic
1095543625 12:43340421-43340443 ACATTGGGTCCTTGGCCTGTGGG - Intergenic
1096195276 12:49645641-49645663 ACTATGGGCACTAGGTCTGTAGG - Exonic
1096543674 12:52322674-52322696 ACTTTGGGCCCTTGTTCCTTTGG + Intergenic
1098979762 12:76943782-76943804 TCTTTGGGTCATTTGTCTGCAGG - Intergenic
1099938516 12:89157291-89157313 CCTTTTTGCCCTTTTTCTGTTGG + Intergenic
1100521951 12:95383617-95383639 TCTTTGGGCCTTCTGTCTTTTGG + Intergenic
1102587423 12:113933067-113933089 ACTCTGAGCCCTTTATCTGGAGG + Intronic
1104275105 12:127319815-127319837 ACTATGGCCCTTTTGTCTGCTGG + Intergenic
1105385743 13:19927959-19927981 ATTTTTGCCCCTTTGTCAGTTGG + Intergenic
1109591281 13:64486419-64486441 ATTTTGGAACATTTGTCTGTGGG + Intergenic
1110630435 13:77699477-77699499 ACTTTAGGTCCTTTTTATGTAGG + Intronic
1112408139 13:99138786-99138808 ACTTTTGGCTTTTTGTTTGTTGG - Intergenic
1115470335 14:33762210-33762232 AAATTGGTCCCTTTGTATGTAGG + Intronic
1115543713 14:34446180-34446202 ACTTTGGGACCTTGGGCTTTGGG + Intronic
1116157996 14:41233004-41233026 ACAGTCAGCCCTTTGTCTGTGGG + Intergenic
1118732291 14:68676985-68677007 CCTCTGGGGCCTTTGGCTGTGGG - Intronic
1121573940 14:94967895-94967917 ACTTTGGGAACTATGACTGTAGG + Intergenic
1122423656 14:101592791-101592813 ACCTTGGATCCTTGGTCTGTAGG + Intergenic
1122660382 14:103290900-103290922 ACTTGGAGCCCTGTGTCTGTGGG - Intergenic
1130975512 15:88770452-88770474 ACTTTGGGCCCTGTGTTTGGAGG + Intergenic
1131940649 15:97561360-97561382 ACTTTGGGCCTGTTGCATGTGGG + Intergenic
1132631424 16:919512-919534 CCTCCGGGCCCCTTGTCTGTGGG - Intronic
1138801085 16:60030882-60030904 ACTCTGGGCACATTGTCTATGGG + Intergenic
1139777552 16:69325942-69325964 GCTCTGGGTCCTTGGTCTGTTGG - Exonic
1144560537 17:16317228-16317250 AGTTTGTGCCCTTTCTATGTGGG + Intronic
1151109277 17:71655651-71655673 ACTTTGGGGTCCTTCTCTGTAGG + Intergenic
1157410249 18:47457443-47457465 ACATGGGGCTCTTTGTCTGCAGG - Intergenic
1157904473 18:51557067-51557089 ATTTCTGGCCCTTTCTCTGTTGG + Intergenic
1158920814 18:62188496-62188518 ACTTAAGACCCTTTGTCTTTGGG + Intronic
1160096950 18:75882151-75882173 ACTTTGAGCTTTTTGTTTGTTGG + Intergenic
1163806889 19:19405240-19405262 ACTTCGGCCCCGGTGTCTGTGGG - Intronic
1164560999 19:29292196-29292218 ACTCTGGGCCCACTGCCTGTGGG - Intergenic
1165766404 19:38354163-38354185 ACTTTGGGCATTTTGACAGTGGG + Intronic
925381509 2:3430443-3430465 ATTATGTGTCCTTTGTCTGTCGG + Intronic
926698179 2:15785060-15785082 GCTCTGGGGCCTTTCTCTGTGGG + Intergenic
930723243 2:54658055-54658077 CCGCTGGGCCCTTTGTCTGTTGG + Intronic
933492180 2:82999813-82999835 ACTTTGTGCCTATTATCTGTTGG + Intergenic
935621247 2:105131613-105131635 ACTTTGGGTCCTTGGCCTGTGGG - Intergenic
935830406 2:106996064-106996086 ACTGTGGCCCCTGTGTCTGTGGG + Intergenic
941203587 2:162544530-162544552 ACTTTGTGCCCTTTCTGTTTTGG + Intronic
941855455 2:170226479-170226501 ACCTTGGGCCGTTTGCCTGCTGG - Intronic
942763526 2:179427814-179427836 CCTTTGGGCCCTTCCTCTTTGGG + Intergenic
943006184 2:182390605-182390627 AATGTCAGCCCTTTGTCTGTAGG - Intronic
943738696 2:191387421-191387443 AGTTTGGGTTCTTGGTCTGTAGG - Exonic
947883789 2:233545819-233545841 ATTTGGGACCCTTTGTCTGTGGG + Intronic
948350407 2:237335619-237335641 GCTTAGGGCCCCTTTTCTGTGGG + Intronic
948541483 2:238694092-238694114 TCTTTGGGAACTGTGTCTGTAGG - Intergenic
949010926 2:241677929-241677951 ACATTTGGCGCTTTGTCTGGTGG - Intronic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1172275381 20:33676321-33676343 ACTTTCGGCCCTTTTGCTCTGGG - Exonic
1174008273 20:47427870-47427892 ACTTCGGGCGCATTGCCTGTGGG - Intergenic
1177816579 21:25984412-25984434 ACTTTCGGCCTTTTTTATGTGGG - Intronic
1178297444 21:31422188-31422210 ACTTTGAGACTTTTGTATGTAGG - Intronic
1178639832 21:34337035-34337057 ACTTTGGGGCTTTTGTTAGTTGG + Intergenic
1179634269 21:42697220-42697242 ACTTTGGGCCCTTTGTCTGTAGG - Intronic
1180869300 22:19137432-19137454 GTTTTGGGCTCTTTGTCTGCAGG - Exonic
1182135500 22:27898831-27898853 ACTTTTGCCCCTTTATATGTTGG - Intronic
1183222703 22:36527143-36527165 ACTTTGGGCCTGAGGTCTGTGGG - Intronic
954883212 3:53849808-53849830 ACTTTGGGCCTTATCTCTGATGG - Intronic
963661020 3:148129331-148129353 AATTTCAGCCCTTTGTCTATAGG - Intergenic
964936200 3:162091274-162091296 ACTTTGGTGGCTTTGTTTGTGGG + Intergenic
965996169 3:174885273-174885295 AATTTCAGCTCTTTGTCTGTAGG + Intronic
968768131 4:2485455-2485477 ACCTTGGGCCCTTTCTCCCTGGG + Intronic
969189434 4:5505161-5505183 ACTCAGGGCCCTTTGTCTGTTGG - Intergenic
972655824 4:41062712-41062734 ACTTTGTGCCTTTTTTCTGGTGG - Intronic
974305475 4:60132959-60132981 ACTCTGACCCCTGTGTCTGTAGG + Intergenic
978824380 4:113002936-113002958 ACTTTGCCCACTTTGTCTCTTGG + Intronic
979590344 4:122471858-122471880 ACTTAGAGCCCTTTGTAGGTTGG - Intergenic
981736732 4:147961362-147961384 TCTTTTGCCCTTTTGTCTGTTGG + Intronic
990025111 5:51178658-51178680 ACATTCTGCCCTTTGTCTGAAGG + Intergenic
991905836 5:71509906-71509928 CCTCTGGGCCATTTTTCTGTGGG - Exonic
993061576 5:83044729-83044751 ATTTTTGCCCATTTGTCTGTGGG - Intergenic
994764043 5:103893775-103893797 ACTTTGGGCTCCTTGACTTTAGG + Intergenic
998362772 5:141604083-141604105 ACTCTGAGCACTTTCTCTGTTGG - Intronic
1003326264 6:5093671-5093693 AATTTGGCCCCATTCTCTGTAGG + Intergenic
1004613546 6:17268528-17268550 ACTCTGAGCCCTTAATCTGTGGG - Intergenic
1006700599 6:35969894-35969916 ACTTTGGGCTCAGTGTCTCTTGG + Intronic
1007092608 6:39193574-39193596 TCTTTGGCCCCTTTGTCTGAAGG - Intronic
1011142273 6:84171953-84171975 ACCTTAGGCCCTTTGGCTTTGGG - Intronic
1012665971 6:101970434-101970456 ACTTTAGGCACACTGTCTGTGGG - Intronic
1014930014 6:127324739-127324761 ACTTTGGGTCTTTGGTCTTTGGG + Intronic
1018971156 6:168530438-168530460 ACTTTTGGCCGTTTTTCTGCTGG - Intronic
1020197284 7:6051135-6051157 ACCATGGGCTCTTTGTATGTTGG - Intronic
1020710466 7:11598447-11598469 ACTATGGCCCCTTTGTTCGTGGG - Intronic
1022459559 7:30592666-30592688 AGTTTAGCCCCTTTCTCTGTTGG - Intergenic
1022898052 7:34772925-34772947 ACTTTGGACTCTTTGTGTCTAGG - Intronic
1026222944 7:68416057-68416079 ACTCTGGGCACACTGTCTGTGGG + Intergenic
1026896936 7:74014749-74014771 ACTTTGGGCACTTTGACCTTGGG - Intergenic
1031850630 7:126858528-126858550 TCTTTTAGCCCTTTATCTGTTGG - Intronic
1032427752 7:131835101-131835123 ACTTTTGGCTCTTGGTCTTTAGG + Intergenic
1047606410 8:126478868-126478890 GCATTGGGCCCCTTGACTGTGGG - Intergenic
1050117242 9:2275654-2275676 ACTTTCGGCCCTTATCCTGTAGG + Intergenic
1052423985 9:28279800-28279822 ACTTTAGGCTCTTTGTGGGTGGG - Intronic
1055205266 9:73722411-73722433 ATTTTCAGCCCTTTGTCTATAGG - Intergenic
1056188022 9:84155519-84155541 ATTTCAGGCCCTTTCTCTGTCGG - Intergenic
1059352395 9:113674842-113674864 AATGTGGTCCCTCTGTCTGTGGG + Intergenic
1061975114 9:134064197-134064219 ACTTTGGGCCATTCACCTGTTGG - Intronic
1186374789 X:8987957-8987979 ACTTTGGGGCCCATGTCAGTGGG + Intergenic
1187563571 X:20426042-20426064 AATTTGTGTCCTTTGTCTCTAGG - Intergenic
1187856000 X:23636761-23636783 ACTTGGCTCCCTTTGTCTTTGGG - Intergenic
1189219169 X:39356349-39356371 GCTCTGGGCCCTGTGTCTGGCGG - Intergenic
1192311559 X:70019913-70019935 ACTTTGAGCCCTGTTTCTGTTGG + Intronic
1193802312 X:85951621-85951643 ACTTTTGCCCATTTGTCTATTGG - Intronic
1193978832 X:88157040-88157062 AATTTTAGCCCTTTGTCTGCAGG - Intergenic
1194398847 X:93418986-93419008 ACTACTGCCCCTTTGTCTGTGGG - Intergenic
1195539969 X:106052537-106052559 ACTCTGGGCACACTGTCTGTGGG - Intergenic
1197372394 X:125640702-125640724 AATTTCAGCCCTTTGTCTATAGG + Intergenic
1197749084 X:129952721-129952743 CTCTTGGGCTCTTTGTCTGTCGG + Intergenic
1199214434 X:145249320-145249342 CCTTTGTCCTCTTTGTCTGTGGG - Intronic