ID: 1179640587

View in Genome Browser
Species Human (GRCh38)
Location 21:42745155-42745177
Sequence TCTCAGAGGCAGAAGGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 496
Summary {0: 1, 1: 1, 2: 5, 3: 46, 4: 443}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179640587 Original CRISPR TCTCAGAGGCAGAAGGTGAA GGG Intronic
901372680 1:8813689-8813711 ACTCAGAGGCAGAGGTTGCAGGG - Intronic
901511897 1:9721746-9721768 TCTCGGAGCTGGAAGGTGAAGGG - Exonic
901693118 1:10986943-10986965 CCTGAGAGGCAGAAGGTGAATGG + Intergenic
901932132 1:12602559-12602581 TCTAATATGCAGAAGGAGAAGGG + Intronic
902034065 1:13443750-13443772 TCTGTGAGGCACAAGGAGAAAGG + Intergenic
902116023 1:14121911-14121933 GCCCAGAGGCAGAAGGTGCCTGG + Intergenic
903192777 1:21666197-21666219 TCTCAGAGGCACAGGGTGCCAGG + Intronic
903275618 1:22219465-22219487 GCCCAGAGGCAGAAGAGGAAAGG - Intergenic
903367847 1:22815933-22815955 TCTGAGAGGCAGAAGGTGTGTGG + Intronic
903411578 1:23148123-23148145 TCTCAGACCCAAAAGGTAAAGGG + Intronic
904324622 1:29720278-29720300 GCCCAGAGGCAGCAGGTGCAGGG - Intergenic
904852489 1:33469310-33469332 ACAATGAGGCAGAAGGTGAAAGG + Intergenic
905342543 1:37289229-37289251 TCTCAGGAGCTGAAGGAGAAGGG + Intergenic
905484511 1:38285947-38285969 TGTCAGAGGCAGAAGGCAAGAGG - Intergenic
905915678 1:41682715-41682737 TCTCAGAGGCAGCAGGAGGGTGG - Intronic
906607653 1:47183017-47183039 GCACAGAGGCAGAGGGTGAGCGG + Intergenic
907221742 1:52911978-52912000 TCTCTGAGGCAGAAAGAGCAAGG - Intronic
908499958 1:64733281-64733303 TCTCAGATGCAGGAACTGAAGGG + Intergenic
909806307 1:79876786-79876808 TCCCAGAGGCAGCAGGGGAAGGG - Intergenic
909912404 1:81277315-81277337 TCACAGAGGCAGAAAGTGATAGG - Intergenic
911426452 1:97720287-97720309 TCACAGATGCAGTAAGTGAAAGG - Intronic
912086911 1:106018387-106018409 ACACAGAGGCAGAAAGTAAATGG + Intergenic
912373765 1:109193596-109193618 TCTCAGATGCAGAAAGTACATGG - Intronic
913685411 1:121227216-121227238 TATCAGAGGCTGAAGGTCACCGG + Intronic
914037258 1:144014820-144014842 TATCAGAGGCTGAAGGTCACCGG + Intergenic
914152197 1:145053112-145053134 TATCAGAGGCTGAAGGTCACCGG - Intronic
914414568 1:147468291-147468313 TCTCAGAGGCAGCAGAGGAAGGG + Intergenic
914745641 1:150499112-150499134 TCTCAGAGGCATCTGGTGAGTGG + Intronic
915929238 1:160048506-160048528 TCCCAGGGGCAGCAGGTGCAGGG + Intronic
916282441 1:163066825-163066847 TATCAGAGAAAGAAGGTGGAAGG + Intergenic
916562650 1:165946555-165946577 GCTCTGAGGTATAAGGTGAAAGG - Intergenic
916780516 1:168022707-168022729 TACCAGAGGCACAAGGTGCAAGG - Intronic
917241410 1:172952468-172952490 TCTTAGAGCAAGAAGATGAAAGG + Intergenic
917983312 1:180288503-180288525 ACTCACAGGCAGAGGCTGAAAGG + Exonic
918014523 1:180620174-180620196 TCCCAATGGCAGAAGGTGGAAGG - Intergenic
918689406 1:187461884-187461906 TCTCAGAGGTAGATAGTGATGGG + Intergenic
919025971 1:192170928-192170950 TCTCAAATGCAGGTGGTGAAAGG + Intronic
920472729 1:206245774-206245796 TATCAGAGGCTGAAGGTCACCGG + Intronic
921229560 1:213054968-213054990 TCTCAGCAACAGTAGGTGAATGG + Intronic
921919325 1:220648596-220648618 TTTCAAAGGCTGATGGTGAATGG - Intronic
922623504 1:227011892-227011914 CATTAGAGGCAGAGGGTGAATGG + Intronic
923274115 1:232382025-232382047 TCACAGAGGGAGAAGCTCAAAGG - Intergenic
923518684 1:234719565-234719587 TTGCAGGGGCAGAAGCTGAAAGG - Intergenic
923692322 1:236206802-236206824 TCTCAGAGCCACAGGCTGAAAGG - Intronic
1064391873 10:14949444-14949466 TTTAAGTGGCAGAAAGTGAATGG - Intronic
1065400863 10:25299628-25299650 TCTAAGTGTCAGAAGATGAATGG - Intronic
1066046610 10:31600864-31600886 TCTGAGAAGCAGGAGGTGAGAGG - Intergenic
1066290841 10:34013150-34013172 TCTCAGGGTCAGGAGGTGAGGGG - Intergenic
1067653326 10:48172938-48172960 TCTCAGTGACAGATGGTGAGAGG - Exonic
1068556048 10:58460159-58460181 TCTAAGAGGCAGAGGATGCAAGG + Intergenic
1069059541 10:63881088-63881110 ACACAGAGGCTGAAAGTGAAGGG - Intergenic
1070444920 10:76488334-76488356 TCTCAGAGGCAGAGGCAGACAGG - Intronic
1070470895 10:76778354-76778376 TCTCAGAGCAAGTTGGTGAAAGG + Intergenic
1071264219 10:83949856-83949878 ACTCACAGGCAGAAGGTGAAGGG - Intergenic
1071431794 10:85612378-85612400 TTTCAGAGGTAGAAGGTCCAAGG - Intronic
1072063762 10:91844513-91844535 TCTCAGAGGCTGCAAGTCAAAGG - Intronic
1074278264 10:112025408-112025430 TCCCAGAGCCAGAGGGAGAAGGG + Intergenic
1075202019 10:120412473-120412495 TCCTAGAGGCAGAAGCTGAGAGG + Intergenic
1075493422 10:122895021-122895043 CCTGAGAGGCAGAAGTTGCAGGG - Intergenic
1075959933 10:126559593-126559615 AGGCGGAGGCAGAAGGTGAAAGG - Intronic
1076496420 10:130900486-130900508 ACTCAGAGGCAGAGGCTGCAGGG + Intergenic
1077549502 11:3193778-3193800 TCTCAGAAGCAGAAAGTCCAGGG + Intergenic
1078254503 11:9646394-9646416 TCCCAGAGGGAGAGGATGAATGG + Intergenic
1078312155 11:10255048-10255070 TCACAGAAGCAGAGGGTGAATGG + Intronic
1078357210 11:10641490-10641512 TTTGAGAGGCAGAGGGTGAGAGG - Intronic
1078396949 11:10989548-10989570 ACTCAGAGGCAGAAGCTGCAGGG - Intergenic
1078455164 11:11469284-11469306 TCACAGAGGGAGCAGATGAAAGG + Intronic
1078852447 11:15177235-15177257 TCCCAGAGGGAGAATGGGAATGG + Intronic
1078869127 11:15327792-15327814 TCTTAGAGGGAGAAGGGGGATGG + Intergenic
1079399860 11:20097974-20097996 TCTCAGAGTCATAAGGCTAATGG - Intronic
1080832406 11:35907871-35907893 TCTCAGAGAAAGAAGCTGATTGG - Intergenic
1081467689 11:43337484-43337506 TCTCAGAGTCTGGAGGGGAAGGG - Intronic
1081698099 11:45132653-45132675 GCTCAGAGGCAGATTGTGAAAGG - Intronic
1082017054 11:47497638-47497660 TCTCAGAGTCAGTCGGGGAATGG - Intronic
1083434043 11:62630593-62630615 TCTAAGAGGCGGAAGGTAAGGGG - Exonic
1084967793 11:72753429-72753451 TCCCAGAGGGACAGGGTGAATGG - Intronic
1085261571 11:75208500-75208522 TTTCAGGGACAGAAGGGGAAGGG - Intergenic
1086152433 11:83626803-83626825 ACCCAGAGGCAGAACCTGAAAGG - Intronic
1086439600 11:86814865-86814887 TCTGAGAGGCAGAAAGTGCAGGG + Intronic
1086461787 11:87013068-87013090 TCTGAGAGGCACAATGTGGATGG - Intergenic
1086599708 11:88617798-88617820 TCTCAGGGACAGAAAGTGAGAGG + Intronic
1087209599 11:95433309-95433331 TTTCAGAGGAAGGAAGTGAAGGG - Intergenic
1087944390 11:104140593-104140615 TCCCAGAGGGAGAAAGAGAAGGG - Intronic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1088438771 11:109844882-109844904 TCACAGAGCTAGAAAGTGAAAGG - Intergenic
1088888728 11:114028316-114028338 TCCCAGAGGCAGTGGGGGAATGG - Intergenic
1088951122 11:114571181-114571203 TCTCAGAAGAAGATGCTGAATGG + Exonic
1089295044 11:117462290-117462312 TCTCAGAGGGAGAGTGTGACTGG - Intronic
1089812331 11:121142329-121142351 GCTCAGAGGCAGGAGGTCAGAGG - Intronic
1090077224 11:123587102-123587124 GCAGAGAGGCAGCAGGTGAAGGG - Intronic
1090466879 11:126942844-126942866 TCTCAGAGAGAGAAGGAAAAGGG - Intronic
1090939344 11:131373653-131373675 TCTCAGTGGCAGAAGGTGGGCGG - Intronic
1091192840 11:133708717-133708739 AGTCAGAGGCACAAGGTGGAGGG - Intergenic
1091296810 11:134479697-134479719 TGGCAGAGGGAGAAGGTGAAAGG + Intergenic
1091617285 12:2059219-2059241 GCTGAGATGCAGAAGGTGAGGGG + Intronic
1091976034 12:4826376-4826398 GCTCAGAGGCAAAAGCAGAAAGG + Intronic
1091993529 12:4975190-4975212 AATCAGAGGCAGGAGATGAAAGG - Intergenic
1092156224 12:6283387-6283409 TCACAGAGACAGAAGTAGAATGG + Intergenic
1092504112 12:9077744-9077766 TCCCAGAGGCAGAAGGACAATGG - Exonic
1092511193 12:9158463-9158485 TCCCAGATGCAGAAGGACAATGG - Exonic
1092627597 12:10344164-10344186 TATCAGAGGCTGAAGGTACAGGG - Intergenic
1092722422 12:11454930-11454952 TATCAGAGGGTGAAGGTGGAAGG + Intronic
1092834856 12:12477772-12477794 CCTCAGAGGCAGCAGGACAAAGG - Exonic
1093874733 12:24336759-24336781 TCTGAGAGGGAGAAGATGAGAGG + Intergenic
1095122044 12:38430884-38430906 GCTGGGAGGCAGAAGGTGATGGG + Intergenic
1095397503 12:41777448-41777470 TCTTAGAGGCATAAGGTAATAGG - Intergenic
1095971735 12:47906079-47906101 GCTCAGAGGGACAAGGTGAAAGG + Intronic
1096549798 12:52364553-52364575 TCTCAGAGGCAGAAGGACTGCGG - Intronic
1097012923 12:55966094-55966116 TCTCTGAGGGAGAAGAGGAAGGG - Intronic
1097628472 12:62030640-62030662 TGTCAGAGCAAGAAGGTGAAAGG + Intronic
1099123458 12:78721777-78721799 TTTCAGAGTCAAAGGGTGAAAGG - Intergenic
1099142049 12:78990177-78990199 TCACAGAGGCTGCTGGTGAATGG - Intronic
1099224545 12:79953962-79953984 ACACACAGGCTGAAGGTGAAGGG - Intergenic
1100962125 12:99974557-99974579 TCTTAAAGGCTGAAGGGGAAGGG - Intronic
1102172316 12:110851712-110851734 TTTCAGAGGGCGAAGGTGCAGGG - Intronic
1102522431 12:113486920-113486942 CCACAGAGGCAGCAGGTGTAGGG - Intergenic
1102584677 12:113914724-113914746 TCTCCGAGGCAGATGGAGAAAGG - Intronic
1102752734 12:115309785-115309807 TATCAGAGGCTGCAGGTGGATGG - Intergenic
1102847510 12:116202724-116202746 TGTCAGGGGAAGAAGGTTAAGGG - Intronic
1103388639 12:120553978-120554000 CCTGAGAGGCAGAAGCTGCAGGG - Intronic
1103483288 12:121265260-121265282 TGTCAGAGGGAGGATGTGAAAGG + Intronic
1103617939 12:122166876-122166898 TTTCAGTGACAGAAGGAGAAAGG + Intergenic
1103719020 12:122963694-122963716 TCTGAGATGCAGAGGGGGAATGG + Intronic
1104248152 12:127062518-127062540 ACTCAGAGACAGAAAGTTAAGGG + Intergenic
1104418936 12:128619367-128619389 AGTCAGAGGCAGTAGGTGACGGG - Intronic
1105203327 13:18197413-18197435 TCTGGGAGACAGAAGGGGAATGG - Intergenic
1105804896 13:23947050-23947072 TCTCACAGGCATCAGGTGCATGG + Intergenic
1105891572 13:24685979-24686001 TCTTAGAGGCAGAAGGGACATGG + Intronic
1106340600 13:28823084-28823106 TCTCAGAGGCAGGATGCCAAGGG + Intronic
1106895741 13:34300426-34300448 CCTCAAAGGCAGAAAGAGAAAGG + Intergenic
1108398031 13:50008950-50008972 TCCAAGAGGCAGAAGTTGCAGGG + Intronic
1109337741 13:61013990-61014012 GCTCAGAGGGAGGAAGTGAAGGG - Intergenic
1110488466 13:76073630-76073652 ACTTACAGGCTGAAGGTGAAGGG + Intergenic
1111233964 13:85383741-85383763 TCACAGAGGGAGAAGGTAGAGGG - Intergenic
1112262070 13:97886143-97886165 TCTCTGAGGCAGAGGGGGAATGG + Intergenic
1112527425 13:100164877-100164899 TCACAGAGACAGAAAGTAAAAGG - Intronic
1113090047 13:106608325-106608347 TCACAGAGGCAGAGGTAGAATGG + Intergenic
1113927404 13:113949423-113949445 TCACAGACCCTGAAGGTGAAGGG - Intergenic
1114227313 14:20750924-20750946 TCTCTGTGCCAGAAGGAGAAAGG - Intergenic
1114320777 14:21545554-21545576 TCTGAGAGGCAGAGGTTGCAGGG - Intergenic
1114533534 14:23409614-23409636 TCTCAGAGGCTGTAGGTGTCAGG + Intergenic
1115329708 14:32183233-32183255 TCTTGGAAGCAGAACGTGAAAGG - Intergenic
1116712755 14:48389954-48389976 TCTATGAGGCAGAAGGAGAAAGG + Intergenic
1116791772 14:49346942-49346964 CCTGAGGGGCAGAAGGAGAAGGG - Intergenic
1117345418 14:54827222-54827244 TTTAAGAGGGAGAAGCTGAAGGG - Intergenic
1117961578 14:61168640-61168662 TCTTAGAGGAATAGGGTGAAGGG - Intergenic
1118249242 14:64142986-64143008 TCTGGTAGGCAGAAGATGAATGG + Intronic
1118626963 14:67668424-67668446 ATTCAAAGGCAGAAAGTGAATGG + Intronic
1119382356 14:74237359-74237381 TGCCAGAGGCTGAAGGTGAAGGG - Intergenic
1119499365 14:75110590-75110612 TCTCAGAGACAGAAAGCAAATGG - Intronic
1122686435 14:103510073-103510095 TGACAGGGGCAGATGGTGAAAGG - Intergenic
1122864082 14:104595669-104595691 TCTCAGAGGCAGGAGATGCAGGG + Intronic
1124163950 15:27301486-27301508 TGTCAGGGGAAGAAGGGGAATGG + Intronic
1124682102 15:31740499-31740521 TCCCAGAGGAAGGAGGAGAATGG + Intronic
1124812173 15:32952072-32952094 CCTCTGAGGCTGAAGGTGCATGG - Intronic
1126373164 15:47968026-47968048 TCTCAGAGTAAGAAGGTGTCAGG - Intergenic
1126524778 15:49640092-49640114 TGTCAGGGGAAGAAGGGGAATGG - Intronic
1128294744 15:66508559-66508581 TCTCAGAGGCAGCAGGAAATTGG - Intronic
1128505461 15:68267959-68267981 TTGCATTGGCAGAAGGTGAAAGG + Intergenic
1128760312 15:70212328-70212350 TCTGAGAGGAAGAAGTGGAAAGG - Intergenic
1129682096 15:77663759-77663781 TCCCAGGGGCTGAAGCTGAAGGG + Intronic
1129921571 15:79323629-79323651 CCTCAGAGGGTGAAGGAGAAGGG - Intronic
1129948393 15:79562236-79562258 TATTAGAGGCAGAAGGAAAATGG + Intergenic
1131577876 15:93610335-93610357 TGTCAGAGGCAGATGGAGACTGG + Intergenic
1131714794 15:95096691-95096713 TCTGCCAGGCAGAAGGGGAATGG - Intergenic
1131828512 15:96339461-96339483 TCTCACAGACTGAAGGTAAAGGG - Exonic
1131951561 15:97687013-97687035 TTTCAGGGGCAAAAGGTAAATGG + Intergenic
1132478273 16:153333-153355 TCTGACAAGCAGAGGGTGAAAGG + Intronic
1132480358 16:163923-163945 TCTGACAAGCAGAGGGTGAAAGG + Intronic
1133658174 16:7887459-7887481 TCTCAGAGGGAGGACTTGAAAGG - Intergenic
1135423944 16:22323065-22323087 TCTGAGAGGAAGGAGGAGAAAGG - Intronic
1135865818 16:26100927-26100949 GCTCAAAGGCAGGAGATGAAAGG + Intronic
1137451598 16:48579739-48579761 TCACACAGACTGAAGGTGAAGGG + Intronic
1139673178 16:68505536-68505558 TCTCAGAGGCAGAAGGTGAGGGG + Intergenic
1140185201 16:72763503-72763525 TCTCAGAAGTAGAAAATGAAAGG + Intergenic
1140976785 16:80067627-80067649 TCTCAGAGGCATCATGGGAAGGG - Intergenic
1141171406 16:81693954-81693976 GCTCAGGGGCAGAAGGTGGAAGG - Intronic
1141632606 16:85296670-85296692 GCACAGAGGAAGAAGTTGAAGGG - Intergenic
1141922732 16:87146812-87146834 TCCCAGAGGCAGAAGTGGAAGGG + Intronic
1142050908 16:87957563-87957585 TCTCAGACACAGAAGGTAACTGG - Intronic
1143764747 17:9130187-9130209 TTCCTGAGGCAGATGGTGAAGGG + Intronic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1146461141 17:33046886-33046908 TCCCAAAGGAAGAAGGTGACTGG - Intronic
1146917079 17:36684913-36684935 TCTCAGAGGGAGTAGAGGAAGGG - Intergenic
1147649110 17:42051844-42051866 TGTCAGAGGCAGACGGTGGGTGG - Intronic
1147655745 17:42089760-42089782 TCTCAGCAGCAGAATGTGTACGG + Intergenic
1148144714 17:45355876-45355898 CCTCAGAGCCAGGAGGTGAGAGG - Intergenic
1148154008 17:45412328-45412350 TCTGAGAGGCACAAGGGGGAGGG + Intronic
1148756750 17:49977109-49977131 TCCCAGGGGCAGAAGGTGAATGG - Intergenic
1149142363 17:53447773-53447795 GGTCATCGGCAGAAGGTGAAGGG + Intergenic
1149329650 17:55567810-55567832 TTTAAGAGGCAGAAGGTAAGTGG + Intergenic
1150354051 17:64468238-64468260 AGACAGAGGCAGAAGTTGAAGGG - Intronic
1150610804 17:66731619-66731641 TGTCAAAGGCAAAAGGTAAAAGG - Intronic
1150669785 17:67182775-67182797 TCTCAGGGTCAGAAGGCCAAGGG - Intronic
1150974705 17:70071890-70071912 AATCAGAGGCAGAAGGAAAAGGG - Intronic
1151512558 17:74570270-74570292 TTTCAGAGACAGAAGGACAAGGG - Intergenic
1152261442 17:79269465-79269487 TCTCAGAGGCAGGAGTGGGAAGG - Intronic
1152685919 17:81693850-81693872 TCTCTGAGGCAGAATCAGAAGGG - Exonic
1152751927 17:82066171-82066193 TTTCAGAGGCGGCAGGTGAGTGG - Intergenic
1153355728 18:4133346-4133368 TCTGATAGGCAAATGGTGAATGG - Intronic
1153843119 18:9024582-9024604 GCTCAGATGCAGAAGTAGAATGG + Intergenic
1154061699 18:11067516-11067538 ACACAGAGACTGAAGGTGAAAGG + Intronic
1155192230 18:23440357-23440379 TCCCACAGGCAGAAAGTAAAGGG - Intergenic
1156339747 18:36200475-36200497 TCTGGGAGGCAGAAGTTGACTGG + Intronic
1156935107 18:42695047-42695069 TCACAGAGGCAGAGACTGAAGGG + Intergenic
1157002104 18:43539053-43539075 ACTCATAGGCAGGAGTTGAACGG - Intergenic
1157110839 18:44818825-44818847 TCACAGAGGGAGATGGTGGAAGG - Intronic
1158380518 18:56924965-56924987 TCACAGAGACAGAAGATTAATGG - Intronic
1159162905 18:64667521-64667543 TCTCAAAGGAAGAAGGGCAAAGG + Intergenic
1160798468 19:956433-956455 TCTCGGAGGAAGAACGTGGAGGG + Intronic
1161456504 19:4372310-4372332 TCACAGAGGAGGAAGCTGAAGGG + Intronic
1161819689 19:6522266-6522288 CCTCAGAGGCAGAAGAAGGAGGG + Intergenic
1162248878 19:9425897-9425919 ACTGAGAGGCAGAAGGGGTAAGG + Intronic
1162527908 19:11217330-11217352 ACTCAGACACAGAAGGCGAAGGG - Exonic
1163501673 19:17680042-17680064 TCTCAGAGGGAAAAGGGGACAGG + Intronic
1163607812 19:18284916-18284938 TCCCTGAGGCAGGAGGTGAGTGG + Intergenic
1164672775 19:30082387-30082409 GGTCAGAGGCAGAAGGAGAGAGG + Intergenic
1165004188 19:32790958-32790980 TCTCAGTTGCAGAAGCTGAAGGG + Intronic
1165147145 19:33738172-33738194 TCACAGAGGCCGATAGTGAACGG - Intronic
1165205218 19:34178600-34178622 GCTCAGAGTCTGGAGGTGAAGGG - Intronic
1165310303 19:35025858-35025880 TCTCAGAGGCAGCAGAGGAAGGG - Intronic
1166168527 19:41009721-41009743 TCACAGAGGCAGAAAGAGACGGG + Intronic
1166317442 19:41997130-41997152 TCTGAGACGCAGAAGGGGACGGG + Intronic
1166582256 19:43912107-43912129 TCTCAGAAGCATTAAGTGAAAGG + Intergenic
1166892447 19:46001709-46001731 TCTCAGAGGCCCAAGGGCAATGG - Intronic
1167024338 19:46904216-46904238 TCACAGATGCGGAAGCTGAAGGG - Intergenic
1167262752 19:48468261-48468283 TCTGAGCGGCAGAAGGTGCCAGG + Intronic
1168181265 19:54664312-54664334 TCTCAGATGCAGTAGGGGATGGG - Exonic
1168187713 19:54710236-54710258 TCTCAGACGCAGTGGGTGATGGG - Intergenic
925897739 2:8486365-8486387 TCACAGAAGCAGAGTGTGAATGG - Intergenic
926010109 2:9400462-9400484 TCTCAGAGGCCGAGGGAGGAGGG - Intronic
926755152 2:16228336-16228358 TTTCTGAGGCAGAACGTAAAAGG + Intergenic
926819688 2:16838901-16838923 TCTCAGAGGCAGCAGGAGAAGGG - Intergenic
927684138 2:25159256-25159278 TCTCAGAGGGAGAAGGTGTGGGG + Intergenic
927746379 2:25625688-25625710 ACTCAGAAGCAGAAGGTACAAGG - Intronic
928491822 2:31792340-31792362 ACTCAGAAGCAGAAAGTCAATGG + Intergenic
929857440 2:45649266-45649288 TTTCAGAGGCAAAATGTAAAGGG - Intergenic
930115373 2:47713552-47713574 TCACAGAGGCAGATTATGAAAGG + Intronic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
931622221 2:64222244-64222266 TCTCTGAGGCAGTACGTGAATGG + Intergenic
931711561 2:64992345-64992367 TGTCAGAAGCAGGAGGTGAAGGG - Intronic
931721951 2:65072901-65072923 TCTCAGACCCAGATGTTGAAGGG + Exonic
933080395 2:77977658-77977680 ACTTAGAGGCAGCAGGGGAAGGG - Intergenic
936960219 2:118065501-118065523 TGTCTGAGGCAGAAGGTCAGAGG + Intergenic
937388300 2:121457407-121457429 TGTTAGTGGCAGAAGGAGAAGGG - Intronic
937536523 2:122895623-122895645 TCTGAGAGGTAGAAAGTCAATGG + Intergenic
937553835 2:123129903-123129925 TCTTAGAGGCAAAACATGAATGG + Intergenic
938004725 2:127779388-127779410 ACTCAGAGGCAGAGGTTGCAGGG + Intronic
940111965 2:150164840-150164862 ACTCAGAGGGAGAAGGAGCAAGG - Intergenic
940235967 2:151511135-151511157 TGTCAAAAGCAGAAGGTAAAAGG + Intronic
940283541 2:152011283-152011305 CCTCAAAGGAAGAAGGTGGAGGG - Intronic
942317310 2:174707956-174707978 TCTAATATCCAGAAGGTGAAAGG - Intergenic
942672595 2:178392366-178392388 TGTGAGAGGCAGAAGGTTTATGG - Intronic
942804238 2:179910940-179910962 TCTCACAGGCAGCAAGTGAGTGG - Intergenic
942868397 2:180704773-180704795 TCTCATAGTCTGAAAGTGAAGGG - Intergenic
943202843 2:184851370-184851392 ACTCAGAAGCAGAAAGAGAATGG - Intronic
943754924 2:191547873-191547895 TCTGAGAGACAGAATTTGAAAGG - Intergenic
943777450 2:191781895-191781917 GCTCACAGGAAGGAGGTGAAGGG + Intergenic
943921608 2:193713730-193713752 TTTCAGAGGCAGAGGGTGGGGGG - Intergenic
944462957 2:199970816-199970838 TCTCAGAGAGAGAAGAAGAATGG - Intronic
945309842 2:208298916-208298938 TCTGAGAGGCAGAGGTTGCAGGG - Intronic
945671352 2:212806131-212806153 TCTTAGTGGCAGAAGGGGCAAGG - Intergenic
945700767 2:213168678-213168700 ACTCAGAGGCAGATGTTGACTGG + Intergenic
946901171 2:224373262-224373284 TCCCAGAGAAAGAAGGAGAAAGG - Intergenic
948436976 2:237960539-237960561 TCTGAGGGGCAGAAGCTGAGAGG - Intergenic
948947604 2:241229012-241229034 CCTGAGAGGCAGAGGGTGACGGG - Exonic
1169321267 20:4635083-4635105 TTTCAGAGGGAGCAGGTGCAGGG - Intergenic
1169331816 20:4722194-4722216 TTTCATAGGCAGAAGCTTAAAGG - Intronic
1170830191 20:19833093-19833115 TGTTAGAGGCAGAAGGTGAGGGG - Intergenic
1170847660 20:19975508-19975530 TCCCAGCTGCAGAAGGTGAGCGG + Exonic
1170886031 20:20340522-20340544 TCTCTGAAGCAGACGATGAAGGG + Intronic
1172033065 20:31995281-31995303 TCCCAGGCGCAGAGGGTGAAGGG - Intronic
1172520293 20:35561531-35561553 GCCCAGAGGCAGAAAGTGACAGG + Intergenic
1172783257 20:37449836-37449858 TTTCAGACGCAGAAGGAGATTGG - Intergenic
1172924058 20:38514292-38514314 TCTCAAAGGCAGGAGGAAAAAGG - Intronic
1173018200 20:39245722-39245744 TCCCAGAGGCAGAAGGAGTAGGG + Intergenic
1173251112 20:41364706-41364728 TGACAGAGGCAGAAGGTGAGGGG - Intronic
1173336955 20:42119901-42119923 TCTCTGAGGCACTAGGTGGAGGG + Intronic
1174403008 20:50285961-50285983 CCTCTGGGCCAGAAGGTGAAAGG + Intergenic
1174925116 20:54750739-54750761 TACAATAGGCAGAAGGTGAAGGG + Intergenic
1177807069 21:25885025-25885047 TCTCAGTGGCAAAAGGTAATAGG - Intronic
1177833845 21:26169761-26169783 TCTGAGAGGCAGAAGGTCCGCGG - Intronic
1178585847 21:33869986-33870008 TTACAAAGGCAGAAGGGGAAAGG - Intronic
1179640587 21:42745155-42745177 TCTCAGAGGCAGAAGGTGAAGGG + Intronic
1180087493 21:45514507-45514529 TCTCAGCGGCCCCAGGTGAATGG - Exonic
1181854246 22:25770838-25770860 TCCCAGAGAGAGAAGGGGAACGG - Intronic
1182290969 22:29279273-29279295 TCACACAGGCAGGAGGGGAAGGG + Intronic
1182947755 22:34340717-34340739 TCTCAGAGTCCCAAGGGGAAGGG - Intergenic
1183124084 22:35758570-35758592 TGTCAGAGGTTGAAGGTCAAAGG + Intronic
1184128720 22:42504660-42504682 TCTCAGTGGCAGAAAGGGACTGG - Intergenic
1184137515 22:42557975-42557997 TCTCAGTGGCAGAAAGGGACTGG - Intronic
1184275545 22:43407654-43407676 GCTCAGAGGCAGCATGTGAGGGG + Intergenic
1185244337 22:49765277-49765299 TCTCAGAGGCAGGAGCTGGGGGG + Intergenic
949441490 3:4085893-4085915 TTTGAGAGGCAGAAGAGGAAAGG - Intronic
949604540 3:5638783-5638805 TCTCAGAGGCAGGCAGAGAAAGG + Intergenic
949826558 3:8171583-8171605 TCTCTTAGGCAGTAGGTGCAAGG - Intergenic
950366474 3:12488752-12488774 TCTCAAAATCAGACGGTGAAGGG - Intronic
950630339 3:14278044-14278066 GCTCAGAGACAGAAAGTGACCGG + Intergenic
952220584 3:31320287-31320309 TCTCAGGTGCAGAAGTTGAAAGG - Intergenic
952950583 3:38521645-38521667 GCAAAGAGGGAGAAGGTGAAAGG - Intronic
954330438 3:49887174-49887196 TTTCAGAGGCAATAGGTAAATGG - Exonic
954363997 3:50136794-50136816 TCTCAGGGGAAGAGGATGAAAGG + Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
955255164 3:57324203-57324225 GCTCAGAGGCAAATGATGAAGGG - Intronic
956175152 3:66465892-66465914 TCTTAGAGACAGAAGTAGAATGG - Intronic
956234889 3:67058706-67058728 TCTTCATGGCAGAAGGTGAAAGG + Intergenic
956286384 3:67614622-67614644 CTTCACAGGCTGAAGGTGAAGGG + Intronic
956771259 3:72527876-72527898 TTTCAGAGCCCGAAGGTGACGGG - Intergenic
959919026 3:111850288-111850310 ACTCAAAGGGAGAAGGTGAGGGG + Intronic
960655686 3:120001459-120001481 AATCATGGGCAGAAGGTGAAGGG - Intronic
960718622 3:120603427-120603449 TCTCAGAGGCAACAGGTTCATGG - Intergenic
961110022 3:124276026-124276048 TCTCAGATGTAGAGGGTGCATGG - Intronic
962632812 3:137296894-137296916 TCTCAGAAGCAAAAGGCAAAAGG - Intergenic
963785922 3:149534360-149534382 TCTCACAGCCAGCAGGTGAAAGG - Intronic
964292490 3:155196758-155196780 GCTCAGAGGCAGAAGGTCCCTGG - Intergenic
967946767 3:194810289-194810311 GCACAGAGTCAGAAGGTGATGGG + Intergenic
968022922 3:195410890-195410912 CCTCAATGGCAGAAGGTGGAAGG - Intronic
968753316 4:2401552-2401574 TCACAGAGCCAGAAGGAGGAGGG - Intronic
969460427 4:7326096-7326118 GCTCAGAGGCAGGTGGTGAGGGG + Intronic
970111236 4:12640128-12640150 TGTCTGTTGCAGAAGGTGAAAGG + Intergenic
971642684 4:29156161-29156183 TGGCACAGGCAGAAGTTGAAAGG - Intergenic
974269731 4:59634416-59634438 AATTGGAGGCAGAAGGTGAAAGG + Intergenic
980694555 4:136337888-136337910 TCTTGGAGGCAGCAGGGGAAGGG - Intergenic
980878439 4:138685842-138685864 CCTCAGGGGCATCAGGTGAAAGG - Intergenic
981009764 4:139913605-139913627 TCTCAGAAGCAGACGTTCAATGG + Intronic
981296008 4:143132234-143132256 TCTTAGAGGCAAGAGGTGATTGG - Intergenic
982644202 4:158002475-158002497 TCTTAGAAGCAGAAGTAGAATGG + Intergenic
982832219 4:160077031-160077053 TCTAAGAGGCAGTAGGGAAATGG - Intergenic
983755411 4:171328917-171328939 TCTCAGAGGCAGGAGATGTGAGG + Intergenic
985904514 5:2823086-2823108 TCTCTGAGGAAGAAGGAAAACGG + Intergenic
986058847 5:4168610-4168632 TCACAGAAGCAGAAAGTAAATGG + Intergenic
986074603 5:4322577-4322599 TCTTAGAGGAAGAAGTTGGAAGG - Intergenic
986212872 5:5690599-5690621 TCTTCGAGGGAGAAGGAGAAAGG + Intergenic
986221090 5:5769473-5769495 TCTGAGAAGCAGAAGATGAAGGG - Intergenic
986496088 5:8343605-8343627 TCATCAAGGCAGAAGGTGAAGGG + Intergenic
986637349 5:9836169-9836191 CCTCACAAGCAGAAGGTAAAAGG - Intergenic
987431877 5:17844880-17844902 TCTTAGAGGCAGCAGAGGAAGGG + Intergenic
987938157 5:24496409-24496431 TCTGAGATGGAAAAGGTGAAGGG + Intronic
988360723 5:30233210-30233232 TCACAGTGGCAGAAGGCGAAGGG + Intergenic
988933288 5:36058348-36058370 TATCAGGGGCTGAAGGTGGAGGG + Intronic
991323336 5:65401447-65401469 TCCCAGCAGCAGAAGGGGAAAGG - Intronic
992374506 5:76175043-76175065 TGAGAGAGGCAGAAGGGGAAGGG + Intronic
993316255 5:86410013-86410035 TGACAAAGGAAGAAGGTGAATGG + Intergenic
994093955 5:95832166-95832188 ACACAGAGGCAGAGGCTGAAGGG + Intergenic
994552591 5:101256468-101256490 TCTCTGAGGCACAATGTAAAAGG + Intergenic
994744949 5:103666565-103666587 TCTCAGAAGCAGAAAGGGAGTGG - Intergenic
996231647 5:121070558-121070580 TTTCAGTGGCTGTAGGTGAAAGG - Intergenic
996262621 5:121492119-121492141 ACACAGAAGCAGAAAGTGAAAGG - Intergenic
997239841 5:132298418-132298440 TCACAGAAGCAGAAAGTAAATGG + Intronic
998199820 5:140110773-140110795 TCTCAGACTAAGGAGGTGAAAGG - Intronic
998216564 5:140242104-140242126 GCTCAGAGGGAGAGGATGAATGG - Intronic
999068544 5:148717497-148717519 CAGGAGAGGCAGAAGGTGAAGGG - Intergenic
999136115 5:149320530-149320552 TTTCTGAGGCAGAAGGTAAAGGG - Intronic
1000207305 5:159074810-159074832 CCTCTGAATCAGAAGGTGAAAGG - Intronic
1000499100 5:162025542-162025564 GCTCAGAGGCAAAATGTCAAAGG - Intergenic
1000687667 5:164272647-164272669 GCTGAGAGGCAGAAAGAGAAAGG + Intergenic
1000850666 5:166336292-166336314 TCACAGAATCAGATGGTGAATGG + Intergenic
1001163952 5:169346644-169346666 TCTAAGGGGCAGAGGGAGAAGGG - Intergenic
1001795878 5:174502064-174502086 TCCCATAAGCAGAAGGTGGAGGG + Intergenic
1002149967 5:177220404-177220426 TCACAGAGGCTGAACGTGAATGG - Intronic
1002207704 5:177575012-177575034 TCTAACAGGCTGAAGGTCAAGGG - Intergenic
1002560293 5:180077022-180077044 TCACAGATGCTGTAGGTGAAGGG + Intergenic
1002630312 5:180570280-180570302 CCCCAGAGGCAGAAGTTGCAGGG + Intronic
1003000520 6:2328014-2328036 TCTCAGAAGAAGAAGGGGGAAGG - Intergenic
1003769022 6:9276505-9276527 TCTCAATGTCAGAAAGTGAAGGG + Intergenic
1004310535 6:14541069-14541091 TCTGCGAGGCAGCAGCTGAAGGG - Intergenic
1004622909 6:17346999-17347021 TCTGAGAGGCACAAGAGGAAGGG - Intergenic
1005943970 6:30582395-30582417 GTTCAGAGGAAGAAGGAGAAGGG + Exonic
1006583866 6:35092720-35092742 ACACAGAGGCAGAATGTGTAAGG - Intergenic
1007820350 6:44556165-44556187 TCCTAGAGGCAGAAGGTGCAAGG + Intergenic
1007888292 6:45257680-45257702 TCCCATAGGTGGAAGGTGAAAGG + Intronic
1009946390 6:70346703-70346725 GCTTGGAGGCAGCAGGTGAAGGG + Intergenic
1010524772 6:76887191-76887213 TGGCAGAGGCAGATGGTGTAAGG - Intergenic
1013156253 6:107492997-107493019 TCTCAAAGTCAAAAGGTGGAAGG + Intronic
1013875808 6:114826248-114826270 TCTCAGAGCCAGAATGAGACTGG + Intergenic
1014284894 6:119486242-119486264 TCACAGAGACAGAAGGTAGAAGG + Intergenic
1014634367 6:123826546-123826568 TCACAGAGACAGAAGCAGAAGGG - Intronic
1015973507 6:138766676-138766698 GGTCAGAGGCAGAGGGAGAAAGG - Intronic
1016092300 6:139994498-139994520 TTTGAGAGGCAGAAAGAGAATGG + Intergenic
1016420596 6:143878474-143878496 TCTCAAAGGCGGAAGGGGAGGGG + Intronic
1016638941 6:146326435-146326457 TTTGAGGGGCAGAGGGTGAAAGG + Intronic
1016930410 6:149401342-149401364 ACACATAGGCAGAAAGTGAAGGG + Intronic
1017207329 6:151817508-151817530 TTTCAGAAGCAGAGGGTAAAAGG + Intronic
1017538766 6:155377818-155377840 TGTCAGAGGCAGAAAGCAAAAGG - Intergenic
1019104561 6:169657508-169657530 GCTACCAGGCAGAAGGTGAAAGG + Intronic
1019132055 6:169884221-169884243 TCTCAGAGGCTGAAGATGCATGG + Intergenic
1019180695 6:170185991-170186013 TCTCAGAGGCAGCAGTGGAGGGG + Intergenic
1020731064 7:11881264-11881286 CCTCAGAAGCAGTAGGAGAATGG + Intergenic
1021385809 7:20028345-20028367 AATCAATGGCAGAAGGTGAAGGG - Intergenic
1022374067 7:29797065-29797087 TCTGGGAGGCAGAAGGTCAATGG + Intergenic
1022465391 7:30649863-30649885 TCTGTGGGGCAGGAGGTGAATGG - Intergenic
1022630259 7:32077991-32078013 TCTGAGAGGCAGAATGTCCACGG - Intronic
1022773722 7:33502271-33502293 TCTCTGGGGAAGAAGGGGAAGGG + Intronic
1022884085 7:34623518-34623540 TCAGAGAGGGAGAAGGTCAATGG + Intergenic
1024780633 7:52843893-52843915 ACACAGATGCAGAAGTTGAAAGG + Intergenic
1025072822 7:55915915-55915937 TGTGAGAGGCAGAGGTTGAAAGG + Intronic
1026540401 7:71275205-71275227 TCTCAGAGTCAGAAGTTGCAGGG + Intronic
1028482201 7:91319595-91319617 TCGCAGAGCCAGAAGGAAAATGG + Intergenic
1028735362 7:94205402-94205424 TCCCAAAGGCAGAAGGAGAATGG + Intergenic
1028868611 7:95740539-95740561 TCTCAAAGACAGTAGATGAATGG - Intergenic
1029591328 7:101509061-101509083 TACTAGTGGCAGAAGGTGAAGGG + Intronic
1029963023 7:104708710-104708732 TCTAAGAGTCAGAAGGGGACTGG - Intronic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1030776517 7:113539733-113539755 ACACAGAGGCTGAAAGTGAAAGG + Intergenic
1031535199 7:122925510-122925532 TCTCAGACTAAGGAGGTGAAAGG + Intergenic
1031581971 7:123487177-123487199 ACTTCGTGGCAGAAGGTGAAGGG - Intronic
1031659840 7:124409010-124409032 TCTCAGGGGCTGATGGAGAAGGG - Intergenic
1032430997 7:131861492-131861514 TCACATAGACAGAAGGGGAAAGG - Intergenic
1032684902 7:134223417-134223439 TCTCAGAGGCAGCAGGGGGTAGG + Intronic
1035079094 7:156201486-156201508 TCTGACAGGCAAAAGATGAAAGG + Intergenic
1035219711 7:157399032-157399054 TCTCAGAGGGTGAGGCTGAACGG + Intronic
1035228645 7:157447513-157447535 TCACAGAGACAGAAGTAGAATGG - Intergenic
1035327906 7:158076682-158076704 TCTCAGGGGCTGAAGGTGAGAGG - Intronic
1035451184 7:158977896-158977918 TCACAGAGACAGAAGGTAGAAGG - Intergenic
1035551407 8:530169-530191 TCTCAGATGCAGAATTTGTATGG + Intronic
1036052995 8:5221019-5221041 TCACAGAGGGAGATGCTGAAGGG + Intergenic
1036076151 8:5503076-5503098 TCACAGAAACAGAAGGTAAAAGG - Intergenic
1037508213 8:19554366-19554388 TAACAGAGGCAGACGGTGAGAGG + Intronic
1038134043 8:24766675-24766697 ATTCAGAGGCAGAAGGGGAGGGG + Intergenic
1039908715 8:41807474-41807496 ATTCACAGGAAGAAGGTGAAAGG - Intronic
1040454505 8:47582751-47582773 TTTCGGAGGCAGAGGCTGAAGGG + Intronic
1040797222 8:51299572-51299594 GCTCATAGGCAGAAGGTGAGAGG - Intergenic
1041926587 8:63243219-63243241 GCTGAGAGGAAGAAGGTAAAGGG - Intergenic
1042401505 8:68353953-68353975 CCTCAGATGCAGAAGGGGATTGG - Intronic
1042676782 8:71330109-71330131 TCTCTGAGGCAGATGATGATAGG + Intronic
1042880341 8:73481143-73481165 ACTCAGAGGGAGAGAGTGAAAGG - Intronic
1043132195 8:76475181-76475203 TTTTAGAGGGAGAGGGTGAAGGG - Intergenic
1043141879 8:76600800-76600822 TCTCAGAGGGAGAAGGTATTGGG + Intergenic
1043655547 8:82661124-82661146 TCTCGAAGGCAGAAGATGGATGG + Intergenic
1043784831 8:84385828-84385850 TCTTAGATGATGAAGGTGAATGG - Intronic
1044310628 8:90687933-90687955 TGACAATGGCAGAAGGTGAAGGG + Intronic
1044928231 8:97227256-97227278 CCTCAGAGGAAGAAGGGCAAAGG + Intergenic
1045340958 8:101254070-101254092 TCCAAGAGGCAGAATGTGAAAGG + Intergenic
1045641574 8:104257293-104257315 TCTCAGAGGAAAAATGTGGATGG - Intergenic
1045780535 8:105857666-105857688 ACACATAGGCAGAAAGTGAAGGG + Intergenic
1046266928 8:111842862-111842884 TCAGGAAGGCAGAAGGTGAATGG - Intergenic
1047366184 8:124213787-124213809 TCTCAGTGGCAGAAGGGTCATGG - Intergenic
1048213919 8:132479442-132479464 TCACAGAGCCAGGAGGTGAGGGG - Intronic
1048631932 8:136252882-136252904 TTTGATTGGCAGAAGGTGAATGG + Intergenic
1048857018 8:138694472-138694494 TCTCTGAGCCAGCAGGGGAAGGG + Intronic
1049220527 8:141426834-141426856 TCTGAGAGGCAGAGGGTGCCAGG - Intronic
1049372228 8:142273391-142273413 TCCAGGAGGCAGAAGGTGATGGG - Intronic
1049655898 8:143797136-143797158 TCCTGGAGGCAGAAGGTGAGGGG + Intronic
1050019030 9:1264809-1264831 TTTCAGAGGAAGAAGAAGAAGGG + Intergenic
1051791912 9:20814598-20814620 TCTGGGAGGCTGAAGGTGGATGG - Intronic
1053034478 9:34812581-34812603 CCTCAGAGACAGAACCTGAATGG - Intergenic
1053390308 9:37730180-37730202 GCTCAAAGGCAGCAGGTGCAAGG - Intronic
1053421878 9:37984866-37984888 CCTCAGAGGCTGAGGGTGAGTGG + Intronic
1053806430 9:41806792-41806814 GCTCTGAGCCAGAAGGTGGAAGG - Intergenic
1055421569 9:76148793-76148815 TATCAGAGGCAGAAGGACTAAGG - Intronic
1057113079 9:92492769-92492791 CCTCAGAGTCAGAAGATGCAGGG + Intronic
1057747434 9:97763183-97763205 CCTTAGAGGCAGAATGTGGAGGG + Intergenic
1058492814 9:105520060-105520082 TCCCAGCGGCAGAAAGTGGAGGG - Intronic
1058648300 9:107151268-107151290 TCTCACAGCCTGAAGGAGAAGGG + Intergenic
1058752183 9:108050420-108050442 TGTTACAGGGAGAAGGTGAAAGG + Intergenic
1058774937 9:108273661-108273683 TCCAAGAGGCAGATGTTGAATGG + Intergenic
1059173056 9:112144837-112144859 TATCAGAGGCAGCAGGTATAGGG + Intronic
1060745249 9:126126940-126126962 GCTCAGAGCCAGCAGCTGAATGG - Intergenic
1061293971 9:129667053-129667075 TTTCAGAGACAGGAGGTGCAGGG + Intronic
1061875276 9:133540431-133540453 TCTCAGTGGCAGAAACTGATGGG - Intronic
1062161473 9:135082708-135082730 TCTGAGTGGCAGCAGGTGAGGGG + Intronic
1062471006 9:136704444-136704466 TCATCGTGGCAGAAGGTGAAGGG + Intergenic
1062472701 9:136713262-136713284 TCCCCAAAGCAGAAGGTGAAAGG - Intronic
1062670862 9:137708391-137708413 TCACAGAGGAAGAAGGTCATTGG - Intronic
1186402392 X:9271683-9271705 TCTCAGAAGTACAAGTTGAAGGG + Intergenic
1187274100 X:17803661-17803683 TCTCTGAGGCAGGAGGAGAAGGG + Intronic
1188744097 X:33820489-33820511 TCATGGAGGAAGAAGGTGAAGGG - Intergenic
1188846060 X:35073961-35073983 TCTCATAGGCAACAGATGAAAGG + Intergenic
1188863755 X:35288812-35288834 TCTCAGAGCCAGAAAATTAATGG + Intergenic
1189135380 X:38543702-38543724 TGTCAGAGATAAAAGGTGAAAGG - Intronic
1190039571 X:47058929-47058951 ATTCAGAGGCAGAAAGTGATGGG + Exonic
1190114326 X:47616300-47616322 TCTGAGATGCAGAAGGGGAAGGG + Intronic
1190794149 X:53725527-53725549 TCTCAGGGGTTGAAGTTGAATGG - Intergenic
1191663216 X:63671514-63671536 TGTGAGAGGCAGAAGGTTGAAGG + Intronic
1191764870 X:64686862-64686884 TATCAGAGTCAGAGGGTGGAGGG + Intergenic
1192013547 X:67301928-67301950 TCACATAGACTGAAGGTGAAGGG + Intergenic
1192189562 X:68982685-68982707 TCCCAGCTGCAGAAGATGAAGGG + Intergenic
1192206879 X:69102188-69102210 TCTTAGAGGCAGAAAGTGAAAGG - Intergenic
1192531494 X:71891038-71891060 TCACAGAGACAGAAAGTAAAAGG - Intergenic
1192910913 X:75603131-75603153 TTTCAGAGTCAGAAAGTGAGTGG + Intergenic
1193140946 X:78026209-78026231 ACTCATAGGTTGAAGGTGAAGGG + Intronic
1193237948 X:79131650-79131672 TTTTAGAGGCAGAGGGTGCAAGG - Intergenic
1193471149 X:81906203-81906225 TCTCACAGACTGAAGGTAAAGGG - Intergenic
1193741821 X:85226235-85226257 TCTTAGAGCAAGTAGGTGAAAGG - Intergenic
1193779058 X:85680823-85680845 TCTCAAAGACAGCAGATGAATGG + Intergenic
1196487211 X:116226151-116226173 TCACAGAAGCAGAAAGTAAATGG + Intergenic
1197079181 X:122391916-122391938 TCACAGAGACAGAAGCGGAATGG - Intergenic
1197125972 X:122946681-122946703 TCTAAGAGGCAGCAGGGGAAAGG - Intergenic
1197840529 X:130741410-130741432 TCTTAGAGGGAGAAAATGAAAGG - Intronic
1199622622 X:149713698-149713720 TATGGGAGGCAGAAAGTGAAGGG - Intronic
1200366220 X:155667500-155667522 GCACAGAGGCAGAAAGTGTAGGG + Intronic
1201616828 Y:15909685-15909707 CCTCAGAGGAAGCAGGTGAATGG + Intergenic
1201797600 Y:17915603-17915625 TCTCAGAGGTAGAAAGAAAAAGG - Intergenic
1201803953 Y:17990356-17990378 TCTCAGAGGTAGAAAGAAAAAGG + Intergenic
1202358955 Y:24084520-24084542 TCTCAGAGGTAGAAAGAAAAAGG - Intergenic
1202511823 Y:25585594-25585616 TCTCAGAGGTAGAAAGAAAAAGG + Intergenic