ID: 1179641094

View in Genome Browser
Species Human (GRCh38)
Location 21:42747615-42747637
Sequence CTCCTGCTTTTCCCTCAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 248}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179641093_1179641094 0 Left 1179641093 21:42747592-42747614 CCTGACACTCACGGGCTAGGTTT 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1179641094 21:42747615-42747637 CTCCTGCTTTTCCCTCAAAGAGG 0: 1
1: 0
2: 1
3: 17
4: 248
1179641092_1179641094 1 Left 1179641092 21:42747591-42747613 CCCTGACACTCACGGGCTAGGTT 0: 1
1: 0
2: 1
3: 7
4: 44
Right 1179641094 21:42747615-42747637 CTCCTGCTTTTCCCTCAAAGAGG 0: 1
1: 0
2: 1
3: 17
4: 248
1179641089_1179641094 6 Left 1179641089 21:42747586-42747608 CCGTCCCCTGACACTCACGGGCT 0: 1
1: 0
2: 1
3: 16
4: 213
Right 1179641094 21:42747615-42747637 CTCCTGCTTTTCCCTCAAAGAGG 0: 1
1: 0
2: 1
3: 17
4: 248
1179641085_1179641094 21 Left 1179641085 21:42747571-42747593 CCCGGGAGCAGGTGGCCGTCCCC 0: 1
1: 0
2: 1
3: 25
4: 296
Right 1179641094 21:42747615-42747637 CTCCTGCTTTTCCCTCAAAGAGG 0: 1
1: 0
2: 1
3: 17
4: 248
1179641091_1179641094 2 Left 1179641091 21:42747590-42747612 CCCCTGACACTCACGGGCTAGGT 0: 1
1: 0
2: 1
3: 3
4: 73
Right 1179641094 21:42747615-42747637 CTCCTGCTTTTCCCTCAAAGAGG 0: 1
1: 0
2: 1
3: 17
4: 248
1179641086_1179641094 20 Left 1179641086 21:42747572-42747594 CCGGGAGCAGGTGGCCGTCCCCT 0: 1
1: 0
2: 2
3: 21
4: 210
Right 1179641094 21:42747615-42747637 CTCCTGCTTTTCCCTCAAAGAGG 0: 1
1: 0
2: 1
3: 17
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179641094 Original CRISPR CTCCTGCTTTTCCCTCAAAG AGG Intronic
900303601 1:1990755-1990777 CTCATATTTTTCTCTCAAAGAGG - Intronic
901272391 1:7962417-7962439 CTCCTGCATTTCACACAATGCGG - Intronic
902341249 1:15784912-15784934 CCCCAGCTTTTCCCTGGAAGTGG - Intronic
903390456 1:22960096-22960118 CCCGTTCTTTTCCCTCAAGGTGG - Exonic
904302613 1:29564676-29564698 ATCCTGCTTTTTGTTCAAAGAGG + Intergenic
904919142 1:33993206-33993228 CTCCTGCCTTCCCCTCTCAGAGG - Intronic
905278010 1:36831479-36831501 CTTCTGCTCTTTCCCCAAAGTGG + Intronic
905306851 1:37025569-37025591 CTCCTGCTTTTCCGCCCAATTGG + Intronic
906517122 1:46446242-46446264 CTCCTTCCGTTCCCTCAAACTGG + Intergenic
906637590 1:47419436-47419458 CTACTGCCCTCCCCTCAAAGAGG - Intergenic
906661570 1:47586639-47586661 GTCCTGTTTTTCCTTCAAATTGG - Intergenic
909752690 1:79182808-79182830 CTACTGCTTATCCATAAAAGGGG - Intergenic
910744837 1:90562154-90562176 CTCCTGCTTCTGCCTCCTAGTGG - Intergenic
912982358 1:114387057-114387079 ATCCTGCTTTTCCCAAGAAGAGG + Intergenic
914357829 1:146902972-146902994 CTCCTGCTTTTCCTCTATAGTGG + Intergenic
915339528 1:155168737-155168759 CACCTGCATTTCCATCAAGGTGG + Intergenic
915715185 1:157938844-157938866 CTTCTGCTTAGCCCTCAAACTGG - Intergenic
916086711 1:161275543-161275565 GTCCAGATTTTCCTTCAAAGAGG + Intronic
916090047 1:161300854-161300876 CTCTTTCTTTCCCCTCAAATAGG + Intergenic
916167644 1:161978069-161978091 TTCCAGCTTTTGCCTTAAAGTGG - Intergenic
916315473 1:163443574-163443596 CTCCTGCTTTTACCTGAGAATGG + Intergenic
916908268 1:169313701-169313723 CTCCTGGTTTTCCCTCATGTTGG - Intronic
917091768 1:171360006-171360028 CTGCTGCTTTTCTTTCAGAGAGG - Intergenic
917762484 1:178177642-178177664 CCCATGCTATTCCCTCAAAATGG - Intronic
918889660 1:190250112-190250134 CTTCTGCTTTTCCCTCTAGGTGG - Intronic
919256560 1:195132558-195132580 CTCCTGCTTCACCTTCTAAGGGG + Intergenic
919646307 1:200098249-200098271 CTCTTGTTTTTCCCCCAAATCGG + Intronic
920070232 1:203297254-203297276 CTCCTGGCATTCCCTCAAACAGG + Intergenic
920544827 1:206807472-206807494 CTCATGCTGTTCCCTCAACCTGG + Intronic
920915442 1:210254479-210254501 CTCCTGCTTTTCCCTTAGCCTGG + Intergenic
923944190 1:238864498-238864520 CTGTTGCATGTCCCTCAAAGGGG - Intergenic
1065224370 10:23528055-23528077 CTCCTCCTTTTCCCTCCTATAGG + Intergenic
1066662473 10:37750122-37750144 TTCCTGCTTTTCTCACAAAGAGG + Intergenic
1069718543 10:70535705-70535727 CTCCTGCTTCTCCTTCAATAGGG + Intronic
1070932918 10:80273538-80273560 CTCCTGCTGCTCCCTCAGACTGG - Exonic
1071145258 10:82561982-82562004 CTACTTCTTTTCTCTTAAAGTGG + Intronic
1071692994 10:87842427-87842449 CTACTGCCTTACCCTGAAAGGGG - Intergenic
1073793550 10:106963447-106963469 TTGCTGCTTTTCCCTAAAATTGG - Intronic
1075376389 10:121981138-121981160 CTCCTGCTTTTACCTCTCATTGG + Intergenic
1076502169 10:130945775-130945797 CTGATGCTTTTCAGTCAAAGAGG + Intergenic
1079094567 11:17502159-17502181 CTCCTGCTTGTCCCTGAACAGGG - Intronic
1079193557 11:18303401-18303423 CTTCTGCTGATTCCTCAAAGAGG - Intronic
1080434784 11:32229739-32229761 CAGCTGCTTTTCCCACAAAAAGG + Intergenic
1081643007 11:44770411-44770433 CCCTTGCTGTTCCCTCAAACAGG - Intronic
1082770086 11:57201151-57201173 CTGCTCCATTTCCCTGAAAGCGG - Intergenic
1085211947 11:74789251-74789273 TCCCTGCATTTCCCTCACAGAGG - Intronic
1085999807 11:81969160-81969182 CTCCTACTGTTCTTTCAAAGAGG + Intergenic
1087106806 11:94417577-94417599 CTCCTACTTTTGCCACAAGGTGG - Exonic
1088000853 11:104878302-104878324 CTCCTGCATCTCTCTGAAAGAGG - Intergenic
1088143154 11:106642967-106642989 CTTCTGCTTTACACTGAAAGTGG - Intergenic
1088668495 11:112118407-112118429 CTCCTCCCTTTCCCCCAAACTGG + Intronic
1091291317 11:134441463-134441485 CCCCTGCTTTTCCCGCAGTGCGG + Intergenic
1091620375 12:2083303-2083325 TTTCTCCTTTTCCCCCAAAGAGG + Intronic
1091716166 12:2777650-2777672 CTCATGCTGTTCCCTCTAATTGG + Intergenic
1095819651 12:46463541-46463563 CATGTGCTTTTCCCTCAAAGAGG - Intergenic
1096070552 12:48773337-48773359 CTCCTCCCTTTCCCCCACAGGGG + Intronic
1096440297 12:51636742-51636764 ATCATGCTTTGCCCTGAAAGAGG - Intronic
1096562051 12:52442768-52442790 TGCCTGCTTTTCCCCCAAGGTGG - Intergenic
1099326439 12:81221716-81221738 CTGCTGCTTTTCCCTTGAACAGG - Intronic
1099631059 12:85146134-85146156 CTCCTTCTTTTCCCTCAGGAAGG + Intronic
1099711310 12:86228532-86228554 TTCCTGCTTCTCCCCAAAAGAGG - Intronic
1102446253 12:113005076-113005098 CTCCTCCTTCTCCCTCCAAAAGG - Exonic
1105531819 13:21227635-21227657 TTCATGCTCTTCCCTCAACGAGG - Intergenic
1106194771 13:27483771-27483793 CTCCTGGGCTTCCCTCACAGGGG + Intergenic
1107058865 13:36134126-36134148 TTCCTGTTTTTCCCTCTAGGAGG + Intergenic
1107447416 13:40481275-40481297 CTTCTGCTTTTCCCTCCACCTGG - Intergenic
1107773467 13:43812743-43812765 CCCCTGCTCTTCACACAAAGAGG - Intergenic
1110662893 13:78078869-78078891 TTCTTGCTTTTCCTTAAAAGTGG + Intergenic
1111489257 13:88948888-88948910 CACCTGCTATTTCCTCGAAGAGG - Intergenic
1112648289 13:101360772-101360794 CTCCTGTCTTTCCTGCAAAGAGG - Intronic
1113486145 13:110653545-110653567 CACCTGGCTTTCTCTCAAAGGGG + Intronic
1114748882 14:25181593-25181615 TTTCTTCCTTTCCCTCAAAGTGG + Intergenic
1116223893 14:42123145-42123167 TTGCTGCTTTTCCTTCAAAGAGG + Intergenic
1118480565 14:66160983-66161005 CTCTTGATTTTCCCCCAAATTGG - Intergenic
1118721977 14:68600768-68600790 CACCAGCTTTTCCCTAAAGGAGG - Intronic
1118861524 14:69668034-69668056 CTCCTGCTTTCCTCACACAGAGG - Intronic
1120698453 14:87671002-87671024 CCCATCCTTTTCCCTCAAATAGG - Intergenic
1120792308 14:88596494-88596516 CTCCTGGTTCTCCCTCTATGAGG - Intronic
1122027000 14:98885479-98885501 CTCATGCTCTTCCCTCCAAATGG + Intergenic
1122301092 14:100731556-100731578 TTCATACTTTTCCATCAAAGAGG - Intronic
1202879289 14_KI270722v1_random:42874-42896 CTCTTCCTATTTCCTCAAAGAGG - Intergenic
1124360800 15:29035371-29035393 TTCATGCTTTCCCCTCAAACTGG - Intronic
1127328822 15:57919285-57919307 CTGCTGCTTCTCTCTCAGAGGGG + Intergenic
1128345625 15:66850736-66850758 CTCCTGCTTCTCCCCAACAGAGG - Intergenic
1129109517 15:73329432-73329454 CTCCTGCTCTTCCCTCACACTGG + Intronic
1130390345 15:83448683-83448705 ATCCTGCTTCTCCCACAAATTGG + Intronic
1131165184 15:90137078-90137100 CTCCTGGTTTTACCTCAAACCGG + Intergenic
1131962069 15:97800400-97800422 GTCCTGATTTTCCCCAAAAGTGG - Intergenic
1132017782 15:98334193-98334215 TTCCTGCTTATCCGTCAAACTGG - Intergenic
1133254284 16:4507095-4507117 GCCCAGCTTTTCCCTCAGAGTGG - Intronic
1133423576 16:5667937-5667959 CTGCTGCCATCCCCTCAAAGTGG - Intergenic
1135259234 16:20966566-20966588 CATCTACCTTTCCCTCAAAGCGG + Intronic
1137627689 16:49920008-49920030 CTCCTGCTTTTCCAGGAAGGTGG + Intergenic
1137679273 16:50325005-50325027 CCCCTGCTTTTCTCACAAAGAGG - Intronic
1138114996 16:54353361-54353383 CTCCTGCTCTCACCTCACAGAGG + Intergenic
1139976354 16:70814320-70814342 CTCCTGCTTTTCCTCTATAGTGG - Intronic
1141295011 16:82759371-82759393 CTCCTGATCTTCCCTAAAATGGG - Intronic
1141570188 16:84929470-84929492 CTCCTGCTCCTCCCTCACCGAGG - Intergenic
1141788777 16:86218816-86218838 CTCCTGCCATTCCCTCAACCTGG + Intergenic
1143590716 17:7884814-7884836 CTCCTCCTCGTCCCTCAGAGGGG - Exonic
1145883604 17:28368481-28368503 GTCTTGCTTCTCCCTCAAAAGGG - Intronic
1147716932 17:42514737-42514759 CTCCTGATTTTGGCTTAAAGGGG + Intronic
1147962743 17:44177789-44177811 CTCCTGCTGCTCCCTCCATGAGG - Intronic
1149339123 17:55668101-55668123 TTCCTGCTTATTCCTGAAAGTGG - Intergenic
1150160669 17:62895203-62895225 TTCCTGCTTGTAGCTCAAAGTGG - Intergenic
1150203369 17:63379739-63379761 CTTCTGGTTTTCCCGCCAAGAGG + Exonic
1150667646 17:67157276-67157298 CACCTGCTTCTTCCTCAAAGAGG + Intronic
1151350063 17:73526403-73526425 CCCCTTCTTTCTCCTCAAAGAGG - Intronic
1156220234 18:35043821-35043843 CTTCTGTTTTTCTTTCAAAGTGG + Intronic
1156309965 18:35912588-35912610 CTCCTGCGTTGCCCTCAGAAGGG - Intergenic
1158530325 18:58255260-58255282 CTGCTGCTTTTCCATCAGAAAGG - Intronic
1159390167 18:67782356-67782378 CTCCATCTTTTCCCTAAAAATGG - Intergenic
1159924625 18:74256784-74256806 TGCTTGCTTTTCCCTGAAAGGGG - Intronic
1160168962 18:76537357-76537379 CTCGCTCTTGTCCCTCAAAGTGG + Intergenic
1163091825 19:15025429-15025451 CACCTTCTTTGCCCTCAGAGGGG - Intergenic
1163241282 19:16065377-16065399 CTCCAGCTTATGGCTCAAAGTGG + Intergenic
1164187052 19:22879585-22879607 CTCCTTCCTTTCCCTTGAAGTGG - Intergenic
1166915728 19:46194957-46194979 CTCCTGCTTTGGCCTCCAAAGGG + Intergenic
1167563851 19:50243745-50243767 CTCCTGTTTTTCACTCATTGTGG + Intronic
1168441612 19:56372606-56372628 CTTCTGTTTTGCCCTCATAGGGG - Intergenic
1202654906 1_KI270708v1_random:11882-11904 CTCTTCCTATTTCCTCAAAGAGG - Intergenic
925184896 2:1840461-1840483 CAGCTGCTTTTCCCACCAAGAGG + Intronic
925532029 2:4874447-4874469 CTTCTTCTTTTCCCTCAGACTGG - Intergenic
925913167 2:8586570-8586592 CTCCTGCTCTTCCAGCCAAGGGG - Intergenic
925991827 2:9260490-9260512 CTCCAGCTTCTCCCACACAGAGG - Intronic
926391971 2:12402959-12402981 CTCCTGCACTGCCCTCACAGAGG - Intergenic
926899346 2:17733170-17733192 TTCCTGCATTTCCCACAAATGGG - Intronic
928135901 2:28687285-28687307 CTCATCCTCTTTCCTCAAAGTGG - Intergenic
929314804 2:40464479-40464501 CTCTTCCCTTTACCTCAAAGAGG - Intronic
931885831 2:66615854-66615876 CTGCTGATTTTTCCTCATAGAGG - Intergenic
931889007 2:66648911-66648933 TTCTTGCTCTTCCCCCAAAGTGG - Intergenic
936107534 2:109637834-109637856 CTCTTTCTTTTCCCTACAAGAGG + Intergenic
937080771 2:119138000-119138022 CTTCTACTTTTCCTTCAAACTGG - Intergenic
939437584 2:142198784-142198806 TTTCTGCTGTTCTCTCAAAGTGG + Intergenic
939931012 2:148232884-148232906 CTCCTTCTCTTTTCTCAAAGAGG + Intronic
940499670 2:154478217-154478239 CTTCTGCTTTTCCCTATTAGAGG - Intergenic
941650784 2:168090391-168090413 CTCATGCTTTCCCCTTAGAGAGG + Intronic
941871817 2:170393547-170393569 CTTTTGCTTTTCCAACAAAGGGG + Intronic
943722754 2:191222113-191222135 AGCCTCCTTTTCCCTCAGAGTGG + Intergenic
943900764 2:193432721-193432743 CTCATGCTATTTCCTCCAAGGGG - Intergenic
944072511 2:195689019-195689041 CTCCTGTGTTTACCTCATAGAGG - Intronic
944995470 2:205288726-205288748 CTCATGCCTTTTCCTCTAAGTGG + Intronic
947223128 2:227813686-227813708 TTCCTGCTTTTTCCTCATATTGG - Intergenic
947816797 2:233042776-233042798 CTCCTGCTTTTCACTGAACTCGG + Intergenic
948845134 2:240679523-240679545 CTCCTGTCTTTCCCCCCAAGGGG + Intronic
948848726 2:240695356-240695378 CTCCTGTCTTTCCCCCCAAGGGG - Intronic
1168924267 20:1566484-1566506 CTCCACCTTTTCCCTCCAGGAGG - Intronic
1168978573 20:1986344-1986366 CTCCAGCTTCTCCCTCCAGGTGG + Intronic
1169869244 20:10233642-10233664 CTTCTGCTTCTCTCTCAAGGTGG + Intronic
1169916776 20:10691150-10691172 ATCCTGTTTCTCCCTCAAAGAGG + Intergenic
1172778682 20:37423051-37423073 CTCTTGCTCTACCCTCATAGGGG + Intergenic
1173498856 20:43538092-43538114 CTGCTTCTGTTCCCACAAAGAGG - Intronic
1176640590 21:9300337-9300359 CTCTTCCTATTTCCTCAAAGAGG - Intergenic
1177604820 21:23364190-23364212 CTCCTGTTTTTCCCTCCAGCTGG - Intergenic
1179159827 21:38885328-38885350 CTCCTGATCTTCCCATAAAGAGG + Intergenic
1179641094 21:42747615-42747637 CTCCTGCTTTTCCCTCAAAGAGG + Intronic
1180349613 22:11789720-11789742 CTCTTCCTATTTCCTCAAAGAGG - Intergenic
1180388590 22:12202520-12202542 CTCTTCCTATTTCCTCAAAGAGG + Intergenic
1181176218 22:21037997-21038019 CTTCTGCTTTTCCCTGTAAATGG - Intergenic
1182882408 22:33744910-33744932 CACCTGCCTTTCCCTCTAAAAGG + Intronic
1182956033 22:34427456-34427478 CTCCTGCTTTTCTGCAAAAGGGG + Intergenic
1182961404 22:34478823-34478845 CTCCTACTTTTCCCTCATGAGGG + Intergenic
1185310274 22:50150461-50150483 CTCCTGCGAATCTCTCAAAGTGG - Intronic
949146120 3:701712-701734 TTCCTGGTTTTACCTCACAGGGG - Intergenic
951060823 3:18204983-18205005 ATCCTACCTTGCCCTCAAAGTGG - Intronic
954701326 3:52452358-52452380 CTCTTGCTCTGCCCTCAGAGAGG - Intronic
957491666 3:80934885-80934907 TTCCTTCTGTTCCCTAAAAGCGG - Intergenic
958095708 3:88941714-88941736 CTCCTGTTTCTCTCTCAAAAGGG - Intergenic
961984132 3:131114532-131114554 CTCTTGCTTTTCCCTCCACCAGG - Intronic
962412350 3:135152376-135152398 CTCCTGCTGTACCCCCAGAGAGG - Intronic
963912109 3:150823690-150823712 CTCCTGCTTTGACTTCCAAGTGG - Intergenic
966377457 3:179311455-179311477 CTTCTACATTTCACTCAAAGTGG - Intergenic
966395043 3:179493910-179493932 CTCTTTCTTTTCCCTACAAGAGG + Intergenic
967042853 3:185709732-185709754 CACTTGCTCCTCCCTCAAAGAGG + Intronic
967175067 3:186855352-186855374 CTCATGCCTTTCCCTCCAACGGG + Exonic
1202746303 3_GL000221v1_random:104687-104709 CTCTTCCTATTTCCTCAAAGAGG + Intergenic
969220400 4:5755110-5755132 CTTCTGCATTTGCCACAAAGGGG + Intronic
970349021 4:15182516-15182538 CTCCTGCTTTTTCAGCAAAAAGG - Intergenic
972105356 4:35478898-35478920 CTCTTCCTTTTCCCTCAAAGGGG - Intergenic
973655632 4:53044651-53044673 CTCCTCCTCCTCCTTCAAAGGGG + Intronic
976613093 4:87049816-87049838 CTCCTAATTTGCCCTCAAAGGGG - Intronic
978145610 4:105367683-105367705 CTCTTTGTTGTCCCTCAAAGAGG + Intergenic
982316859 4:154040823-154040845 CTCCGGCTTTTCCCACACACAGG - Intergenic
982987755 4:162232253-162232275 CTTCTGCATTTCCCTAACAGAGG + Intergenic
983524060 4:168742311-168742333 CTTTTGCTTATCCCTCAAAGGGG + Intronic
984737056 4:183119172-183119194 CTCCTGATTTTCATTCAAATGGG - Intronic
990836070 5:60021756-60021778 CTCCTGCTTTCTCCTGAGAGAGG - Intronic
992492010 5:77254542-77254564 CTTCTGCCTTTCTCACAAAGGGG + Intronic
994383227 5:99096655-99096677 CTCCTGCTTTCCTCTGTAAGAGG + Intergenic
994628295 5:102249604-102249626 CTCCTACTTTTCCCTTAATGAGG - Intronic
996015016 5:118523674-118523696 CTTCTCCTTTTCCTGCAAAGAGG - Intergenic
997000855 5:129760370-129760392 ATTCTTCTTTTCCCTCTAAGAGG - Exonic
997108222 5:131045816-131045838 CTCCTCCATTTCCCTAACAGAGG + Intergenic
997362552 5:133304444-133304466 TTCCTGCCTCTCCCTCCAAGAGG + Intronic
999246176 5:150155901-150155923 CTGCAGCCTTTCCCCCAAAGTGG - Intergenic
1000147364 5:158466544-158466566 CACCTGCATTTGCCTGAAAGAGG - Intergenic
1002452141 5:179325266-179325288 CCTGTGCTTTACCCTCAAAGTGG + Intronic
1003657462 6:8026131-8026153 TTCCATCTTTTCCCTGAAAGTGG - Intronic
1003983608 6:11413331-11413353 CTAGTGCATTTCCTTCAAAGGGG + Intergenic
1004742741 6:18477700-18477722 CTCCTGGCTTTCCCCCAAAAAGG - Intergenic
1005342686 6:24858107-24858129 CTCCTGCTTTTGCAGCAAACTGG + Intronic
1005531661 6:26713253-26713275 CTCCTGCTTTTTCCACACCGAGG - Intergenic
1005539134 6:26788412-26788434 CTCCTGCTTTTTCCACACCGAGG + Intergenic
1006905735 6:37532196-37532218 CTCCCTCTTTTCCCTCTGAGGGG - Intergenic
1007251065 6:40495473-40495495 CTCCTACTTTTCCATGAAACAGG + Intronic
1007564902 6:42842510-42842532 CCCCTGTTTTTCCCACAAATAGG + Intronic
1008563953 6:52749288-52749310 CTCTTTCTTTTCCCTACAAGAGG + Intergenic
1008916657 6:56795035-56795057 CTCCTGGTTTTTCCTATAAGGGG - Intronic
1009009968 6:57830638-57830660 CTCCTGCTTTTTCCACACCGAGG + Intergenic
1009167355 6:60357071-60357093 CTCCAGGTCTTCCCTCAAAAGGG + Intergenic
1009697966 6:67134268-67134290 CTCCTGCCTCTCCCACAATGAGG + Intergenic
1010083161 6:71886930-71886952 CCCCTGCTTCCCCCTCACAGCGG - Intronic
1011866275 6:91832587-91832609 GTTATGCTTTTCCCTTAAAGAGG + Intergenic
1015255543 6:131175693-131175715 CTCCTGCCCTTCCCTGAAGGAGG + Intronic
1015829157 6:137348908-137348930 CTTCTGCTTTTTGCTCAGAGAGG + Intergenic
1016885902 6:148959545-148959567 TTTCTGCTTTTCCCTCTATGGGG + Intronic
1018484554 6:164227833-164227855 CTCCTCCATCTCCCTCAAAGTGG - Intergenic
1019055773 6:169222268-169222290 CTCCGGCGTGTCCCTCAAGGTGG - Exonic
1020181308 7:5924655-5924677 CTCCTGCCTTCCCGCCAAAGCGG + Intronic
1020301625 7:6800235-6800257 CTCCTGCCTTCCCGCCAAAGCGG - Intronic
1022095157 7:27135877-27135899 CTGCTGCTATTCCCTCAGAATGG + Intronic
1023617056 7:42030223-42030245 CTCCTGCTTCCCTCTCACAGGGG + Intronic
1024107868 7:46110836-46110858 TTTCTGCTTTTCCCTCCATGGGG - Intergenic
1025052373 7:55741833-55741855 GTCCTGCTCCTCCCTCACAGTGG + Intergenic
1025478685 7:60957063-60957085 CTCCTTCTTTTCTCCCAACGGGG - Intergenic
1026266574 7:68800622-68800644 CTCCAGCAGCTCCCTCAAAGGGG + Intergenic
1026320137 7:69260907-69260929 CTCCTGCTTTGGCCTCCAAAGGG - Intergenic
1026667043 7:72350621-72350643 CTCCTGCTCCACCCTCAAATAGG - Intronic
1029436809 7:100568291-100568313 GTCCTGCTGCTGCCTCAAAGAGG - Intergenic
1030167972 7:106573579-106573601 CTCCTTCCTTTCCCTCTTAGAGG - Intergenic
1033264975 7:139877122-139877144 GTCTTGCTTTGGCCTCAAAGTGG - Intronic
1034344499 7:150378358-150378380 CTCACACTTCTCCCTCAAAGGGG - Intronic
1035551518 8:531139-531161 CACCTGCCTTTCCCTGAAGGTGG - Intronic
1036610224 8:10343485-10343507 TTCTTGTTTTTCCCCCAAAGTGG + Intronic
1037980370 8:23249123-23249145 CTCCCCCTTTACCCTAAAAGAGG - Intronic
1039809726 8:41035738-41035760 CCCTTGTTTTTCCCTCAAAGGGG + Intergenic
1039881467 8:41627860-41627882 GTCCTGCTTAACCCTGAAAGTGG - Intergenic
1041931969 8:63296656-63296678 CTCCTGCTCTTCCCACAACCTGG - Intergenic
1043618406 8:82157342-82157364 CTGCTGCTTTTCCCCCAAGTGGG + Intergenic
1044584926 8:93860376-93860398 CTCCTGCCTTTCCCATAAACTGG + Intronic
1044648166 8:94466850-94466872 CTCCACCCCTTCCCTCAAAGAGG + Intronic
1044966911 8:97582663-97582685 CCCATTCCTTTCCCTCAAAGTGG + Intergenic
1045912868 8:107430628-107430650 CTCCTGCTTTTCTCTTATAAAGG - Intronic
1046563945 8:115874555-115874577 CTCTTGCTTTTCCCTCAGGATGG + Intergenic
1047108121 8:121757858-121757880 ATCCTGCTTTCCCCACAAGGAGG + Intergenic
1047323075 8:123807397-123807419 CTCCTGCTTTAGCCTCCCAGAGG - Intronic
1047989982 8:130276038-130276060 CTCATACTCTTCCCTTAAAGAGG - Intronic
1049506219 8:143000768-143000790 CTCTTTCTTTTCCCTACAAGTGG - Intergenic
1051358195 9:16259117-16259139 CTCCTGCATGTCCTTCAAAGAGG + Intronic
1052864839 9:33458617-33458639 CTCCTCCTTCTCCCTCTCAGGGG + Intergenic
1055379984 9:75696109-75696131 GGCCAGCTTTTCCCCCAAAGTGG - Intergenic
1056332692 9:85534747-85534769 CTCCTTTTTGTCCCTCCAAGAGG - Intergenic
1057483469 9:95463535-95463557 CGCCTCCTTTCCCCTCAAAAAGG + Intronic
1059281935 9:113141957-113141979 CTCTTGCTCTTCCCTCAATTTGG - Intergenic
1059671999 9:116500588-116500610 CTGCTGCTTTTCCCTCTCAAAGG - Intronic
1060132047 9:121111425-121111447 CTCCTGATTATCCATCAAAATGG - Intronic
1061275664 9:129568524-129568546 CTCCTGCTGTCCTCTCAAAGCGG + Intergenic
1061383911 9:130276939-130276961 CCCCTGCTTCTCTCTCCAAGTGG - Intergenic
1186996973 X:15133941-15133963 CTCCCTCTTTTCCCTGAAGGTGG - Intergenic
1187454749 X:19431263-19431285 CTCATGGTTTTCTCTCAAAAAGG + Intronic
1190780154 X:53586115-53586137 CTACTGATTTTCCCTAAAAGGGG + Intronic
1192552979 X:72068800-72068822 CTCCTGCTTTGCCTTCCCAGGGG - Intergenic
1192612113 X:72577037-72577059 CCCCTGCTTTTCCCCAGAAGGGG + Intergenic
1193305180 X:79941691-79941713 CTCACCCTTTTCCCTCAAATAGG + Intergenic
1194095519 X:89634120-89634142 CTTGTGCTTCTCTCTCAAAGTGG + Intergenic
1194614657 X:96086508-96086530 CTCCTGATTCTACCTCACAGGGG + Intergenic
1200164605 X:154027383-154027405 CACCTGCAGCTCCCTCAAAGAGG - Intronic