ID: 1179641845

View in Genome Browser
Species Human (GRCh38)
Location 21:42752892-42752914
Sequence CTCTCGGCAGAAACCAGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179641839_1179641845 3 Left 1179641839 21:42752866-42752888 CCCCATCAGCAGGCCTGCTCTTC No data
Right 1179641845 21:42752892-42752914 CTCTCGGCAGAAACCAGGAATGG No data
1179641841_1179641845 1 Left 1179641841 21:42752868-42752890 CCATCAGCAGGCCTGCTCTTCTA No data
Right 1179641845 21:42752892-42752914 CTCTCGGCAGAAACCAGGAATGG No data
1179641836_1179641845 16 Left 1179641836 21:42752853-42752875 CCAGGGGCACCGGCCCCATCAGC No data
Right 1179641845 21:42752892-42752914 CTCTCGGCAGAAACCAGGAATGG No data
1179641833_1179641845 29 Left 1179641833 21:42752840-42752862 CCTCAGAAGCAACCCAGGGGCAC No data
Right 1179641845 21:42752892-42752914 CTCTCGGCAGAAACCAGGAATGG No data
1179641840_1179641845 2 Left 1179641840 21:42752867-42752889 CCCATCAGCAGGCCTGCTCTTCT No data
Right 1179641845 21:42752892-42752914 CTCTCGGCAGAAACCAGGAATGG No data
1179641835_1179641845 17 Left 1179641835 21:42752852-42752874 CCCAGGGGCACCGGCCCCATCAG No data
Right 1179641845 21:42752892-42752914 CTCTCGGCAGAAACCAGGAATGG No data
1179641838_1179641845 7 Left 1179641838 21:42752862-42752884 CCGGCCCCATCAGCAGGCCTGCT No data
Right 1179641845 21:42752892-42752914 CTCTCGGCAGAAACCAGGAATGG No data
1179641843_1179641845 -10 Left 1179641843 21:42752879-42752901 CCTGCTCTTCTAGCTCTCGGCAG No data
Right 1179641845 21:42752892-42752914 CTCTCGGCAGAAACCAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179641845 Original CRISPR CTCTCGGCAGAAACCAGGAA TGG Intronic