ID: 1179641845

View in Genome Browser
Species Human (GRCh38)
Location 21:42752892-42752914
Sequence CTCTCGGCAGAAACCAGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 210}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179641838_1179641845 7 Left 1179641838 21:42752862-42752884 CCGGCCCCATCAGCAGGCCTGCT 0: 1
1: 0
2: 2
3: 37
4: 361
Right 1179641845 21:42752892-42752914 CTCTCGGCAGAAACCAGGAATGG 0: 1
1: 0
2: 2
3: 18
4: 210
1179641840_1179641845 2 Left 1179641840 21:42752867-42752889 CCCATCAGCAGGCCTGCTCTTCT 0: 1
1: 0
2: 1
3: 17
4: 206
Right 1179641845 21:42752892-42752914 CTCTCGGCAGAAACCAGGAATGG 0: 1
1: 0
2: 2
3: 18
4: 210
1179641833_1179641845 29 Left 1179641833 21:42752840-42752862 CCTCAGAAGCAACCCAGGGGCAC 0: 1
1: 0
2: 3
3: 15
4: 200
Right 1179641845 21:42752892-42752914 CTCTCGGCAGAAACCAGGAATGG 0: 1
1: 0
2: 2
3: 18
4: 210
1179641839_1179641845 3 Left 1179641839 21:42752866-42752888 CCCCATCAGCAGGCCTGCTCTTC 0: 1
1: 0
2: 1
3: 26
4: 269
Right 1179641845 21:42752892-42752914 CTCTCGGCAGAAACCAGGAATGG 0: 1
1: 0
2: 2
3: 18
4: 210
1179641841_1179641845 1 Left 1179641841 21:42752868-42752890 CCATCAGCAGGCCTGCTCTTCTA 0: 1
1: 0
2: 2
3: 14
4: 165
Right 1179641845 21:42752892-42752914 CTCTCGGCAGAAACCAGGAATGG 0: 1
1: 0
2: 2
3: 18
4: 210
1179641836_1179641845 16 Left 1179641836 21:42752853-42752875 CCAGGGGCACCGGCCCCATCAGC 0: 1
1: 0
2: 1
3: 23
4: 208
Right 1179641845 21:42752892-42752914 CTCTCGGCAGAAACCAGGAATGG 0: 1
1: 0
2: 2
3: 18
4: 210
1179641835_1179641845 17 Left 1179641835 21:42752852-42752874 CCCAGGGGCACCGGCCCCATCAG 0: 1
1: 0
2: 2
3: 14
4: 145
Right 1179641845 21:42752892-42752914 CTCTCGGCAGAAACCAGGAATGG 0: 1
1: 0
2: 2
3: 18
4: 210
1179641843_1179641845 -10 Left 1179641843 21:42752879-42752901 CCTGCTCTTCTAGCTCTCGGCAG 0: 1
1: 0
2: 0
3: 8
4: 147
Right 1179641845 21:42752892-42752914 CTCTCGGCAGAAACCAGGAATGG 0: 1
1: 0
2: 2
3: 18
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179641845 Original CRISPR CTCTCGGCAGAAACCAGGAA TGG Intronic
900034275 1:394002-394024 CTGACTGCAGAGACCAGGAAGGG - Intergenic
900055110 1:623894-623916 CTGACTGCAGAGACCAGGAAGGG - Intergenic
902609268 1:17587744-17587766 CTGTCCCCAGAAAGCAGGAAGGG + Intronic
902972104 1:20061292-20061314 CTCTCAGCACATACCAGGCATGG + Intronic
904063931 1:27733407-27733429 CTCTTTGGAGAAACCAGCAAGGG - Intronic
905076835 1:35279408-35279430 ATCTCAACAGAAACGAGGAATGG - Intronic
907057075 1:51379448-51379470 TTCTCAGCAGAAACCTTGAAGGG + Intronic
907756603 1:57316715-57316737 CTCCCAGCAGAAACTAGGATTGG - Intronic
908004919 1:59718076-59718098 CTCTCAGGAGAAAACAGGATAGG + Intronic
913528260 1:119713707-119713729 CTCTGGGGAACAACCAGGAAAGG + Intronic
913705951 1:121423314-121423336 CTATAGCCAGAAACCAGAAACGG + Intergenic
917222824 1:172749537-172749559 CCCTTGGCAGAAACCAAGCAGGG - Intergenic
917317023 1:173736432-173736454 CTCTGGGCAGTAACCAGTAGTGG + Intronic
917686526 1:177422202-177422224 GTCTCAGTAGTAACCAGGAAAGG - Intergenic
922256631 1:223898199-223898221 CTGACTGCAGAGACCAGGAAGGG - Intergenic
922358496 1:224798968-224798990 ATCTAGGCAGAAAATAGGAAAGG + Intergenic
924337837 1:243001052-243001074 CTGACTGCAGAGACCAGGAAGGG - Intergenic
924507663 1:244701288-244701310 ATCTCGACAGAAACCAAGAATGG + Intronic
1064425099 10:15223355-15223377 CTCTCTGCATCAGCCAGGAAAGG + Intronic
1065846535 10:29748223-29748245 CTCTCTGAAGAAACCAGCACAGG - Intergenic
1072426892 10:95337461-95337483 ATCTGGGGAGAAACCAGGATGGG + Intronic
1073288694 10:102402874-102402896 GTCTCAGCAGAAAGCAGAAACGG + Exonic
1073434171 10:103506213-103506235 CTCTCAGCAGACACCAGGCAGGG - Intronic
1073956185 10:108874195-108874217 CTTTCAGCAGAAAACAGGCAGGG + Intergenic
1076903440 10:133350984-133351006 CTCTCGGCACCAGCCAGGAAGGG + Intronic
1076908741 10:133377155-133377177 CTCCCCGCAGGAACCAGGAACGG + Intergenic
1078140634 11:8690154-8690176 CTCACGGCAGAAAGCAGAAGGGG - Intronic
1079529867 11:21438312-21438334 TTTTCAGCAGAAACCAGGAGAGG - Intronic
1080056510 11:27912146-27912168 CTCTCAGCAGCATACAGGAATGG - Intergenic
1080338007 11:31221664-31221686 ATCTCAGCAGAGACCAGGAATGG - Intronic
1082145752 11:48666210-48666232 CTTTTGGCAGAAACCACGATGGG + Intergenic
1082147845 11:48692529-48692551 CTTTTGGCAGAATCCATGAAGGG + Intergenic
1082582242 11:54886180-54886202 ATTTTGGCAGAATCCAGGAAGGG + Intergenic
1082588514 11:54974436-54974458 GTTTTGGCAGAATCCAGGAAGGG + Intergenic
1082592702 11:55033086-55033108 CTTTTGGCAGAATCCATGAAGGG - Intergenic
1084053427 11:66616181-66616203 CTGGCGGGAGAAACCAGGACAGG - Intergenic
1086080421 11:82898406-82898428 CTATCAGCAGAAAAGAGGAAGGG - Intronic
1088653460 11:111977595-111977617 CTCGCGGGAGAAAGCGGGAACGG - Intronic
1090264517 11:125345500-125345522 CTCTCTGCAAAACCCAGTAAGGG - Intronic
1091896796 12:4111464-4111486 GTTGGGGCAGAAACCAGGAATGG - Intergenic
1093075004 12:14748963-14748985 ATCTGGGGAGAAACTAGGAACGG + Intergenic
1093860250 12:24156342-24156364 CTCCCAGGAGAAACCAGTAAAGG - Intergenic
1095601561 12:44019068-44019090 CTCTGGGCAGAGGCCAGGGAAGG + Intronic
1095929194 12:47608851-47608873 CTGTCAGCAGAAAGCAGAAAGGG + Intergenic
1096029726 12:48402588-48402610 CTCTCAGCAGAAACCCGACAAGG - Intergenic
1096332018 12:50721828-50721850 ATAACTGCAGAAACCAGGAACGG + Intronic
1096332145 12:50722890-50722912 ATAACTGCAGAAACCAGGAATGG - Intronic
1097723631 12:63050255-63050277 CTCTCACCAGAAGCCAGGACTGG - Intergenic
1097788029 12:63782668-63782690 ATCTCAGCAGAAGCCAGAAATGG - Intronic
1101749823 12:107574324-107574346 CTCAAGTCAGAAACCAGGGAAGG - Intronic
1102120585 12:110437821-110437843 TTCTCGGCAGAGACCCTGAAGGG - Intronic
1102718544 12:114996178-114996200 CTCTCATCTGAAAGCAGGAATGG - Intergenic
1103532643 12:121612995-121613017 CCCTCGGAAGGAACCAGGGAAGG + Intergenic
1108525040 13:51279357-51279379 CTCTCGGCATCCAGCAGGAATGG - Intronic
1108833133 13:54504455-54504477 CTCAGGACAGAAACAAGGAATGG - Intergenic
1108985851 13:56586147-56586169 CTATCTGCAGAAAAGAGGAAGGG - Intergenic
1110340208 13:74381504-74381526 CTCTGGGTAGATACCAGGAGTGG + Intergenic
1111522079 13:89417998-89418020 CTGTCGGCAGACATCAGAAATGG + Intergenic
1113542836 13:111122325-111122347 CTCTCTGCAGACACCAGGTGGGG - Intronic
1114563495 14:23610426-23610448 CTCCCAGGAGAAACCAGTAAGGG - Intergenic
1117024714 14:51607805-51607827 CACTCGGCAGAAACCGGGAAAGG - Intronic
1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG + Intronic
1117514266 14:56484963-56484985 GACTCTGCAGAAACCAGGAGGGG - Intergenic
1120228938 14:81821971-81821993 CTTTAGGCAGAAAACAGGGAGGG + Intergenic
1121308879 14:92924028-92924050 CTGTGGGCAGCAACCAGGGAAGG + Intronic
1123680878 15:22762706-22762728 CTCTAGGAAGGAACTAGGAAAGG - Intergenic
1124026374 15:25970202-25970224 TTCCTGCCAGAAACCAGGAAGGG - Intergenic
1124093607 15:26628934-26628956 CTCTCGGCAGTCACAAGGAGTGG - Intronic
1124333088 15:28837164-28837186 CTCTAGGAAGGAACTAGGAAAGG - Intergenic
1124346633 15:28927174-28927196 TTCTCATCAGAAACCAGTAAAGG - Intronic
1125128334 15:36251618-36251640 CACTTGGCTGAGACCAGGAAAGG + Intergenic
1127292996 15:57586768-57586790 CTCCCAGGAGAAACCAGGAAGGG - Intergenic
1128537484 15:68501827-68501849 TTCTCGGCAGAGATCTGGAAGGG - Intergenic
1133268175 16:4597203-4597225 CTCCCAGCAGATACCAGGCAGGG - Intronic
1135904699 16:26500907-26500929 CTCTAGGAAGAGACCAGGACTGG - Intergenic
1135951637 16:26919802-26919824 CTCTCAAAGGAAACCAGGAAAGG - Intergenic
1138156805 16:54713152-54713174 CTCTCTGCAGAAACCATGGTTGG - Intergenic
1138809265 16:60129637-60129659 CTGTGGCCAGAAACCAGGATTGG + Intergenic
1138961033 16:62029574-62029596 CTCTCGGCAGAAAATAGTCATGG - Intronic
1139025229 16:62808414-62808436 CTCTCTGCAGAAAGAAAGAATGG - Intergenic
1140304724 16:73792398-73792420 CTCACTGCAGCAACCAAGAAAGG + Intergenic
1140819695 16:78651585-78651607 TTCTAGGCAAAAAGCAGGAACGG - Intronic
1141622125 16:85241907-85241929 CTCCCGGCAGCCACCATGAAGGG - Intergenic
1141788528 16:86217467-86217489 CTCTCGGCACACTTCAGGAAGGG - Intergenic
1142197555 16:88745799-88745821 CTCTCAGGAGGAAACAGGAAGGG + Intronic
1142793949 17:2292272-2292294 CTCTGGTCAGAAACAAAGAATGG + Intronic
1143048629 17:4103625-4103647 CTCACGGCAGAAGCCAGGTGTGG + Intronic
1143646565 17:8234280-8234302 CTCTCTGCAGCAACTAGAAATGG - Intronic
1143775823 17:9198137-9198159 CTTTCAGGAGAAACCAGTAAGGG + Intronic
1144608303 17:16687094-16687116 CTCAGGACAGAAACCGGGAATGG - Intergenic
1150692214 17:67376884-67376906 CTCTCCTCTGAAACCAGGCAAGG + Intergenic
1151013872 17:70531496-70531518 ATCTCAGCAGAAGCCAAGAATGG - Intergenic
1151338477 17:73455104-73455126 CTCTCTACAGAGACCAGGACAGG + Intronic
1151885722 17:76922315-76922337 TTCCTTGCAGAAACCAGGAAGGG - Intronic
1152913198 17:83017170-83017192 CGCTCAGCAGAGGCCAGGAAGGG + Intronic
1155668045 18:28335443-28335465 CTCTCTGCATGTACCAGGAAAGG + Intergenic
1155840379 18:30635535-30635557 CTCTGGGCAGGAACTAGGCAGGG + Intergenic
1156879935 18:42064927-42064949 CTGTGGGCAGGAACAAGGAAGGG - Intronic
1163212550 19:15851927-15851949 CACTCAGCAGAAATCAGAAAAGG + Intergenic
1163292815 19:16391777-16391799 CTCTCAGGAGACACCAGGCAAGG + Intronic
1167032106 19:46969521-46969543 CTCTCAGGAGCAACCAGGGATGG + Intronic
927255330 2:21036267-21036289 CTCTGGGCAGCACCAAGGAAGGG - Intronic
927263557 2:21119026-21119048 CTCTAGGGACAAAGCAGGAAAGG + Intergenic
927773185 2:25881490-25881512 CTCTCAGAAGAAACCTGTAACGG + Intergenic
929581490 2:43084246-43084268 CTCTTGGCAGAAACCAGAGAAGG - Intergenic
931236830 2:60419170-60419192 CACTGGGCAGAGACTAGGAAGGG - Intergenic
932072226 2:68632340-68632362 CTCTAGGCAGAATGCAGTAAAGG + Intergenic
934165068 2:89286854-89286876 GTATCAGCAGAAACCAGGGAAGG - Intergenic
934202205 2:89895608-89895630 GTATCAGCAGAAACCAGGGAAGG + Intergenic
937510364 2:122588592-122588614 GTCTCAGCTGAAACCATGAATGG + Intergenic
942928111 2:181457415-181457437 CTGGCGGCAGAAACCGGGAGTGG + Exonic
946058023 2:216918397-216918419 TTCTCGGCAGAGGCCTGGAAGGG - Intergenic
947825691 2:233104856-233104878 CTCCCAGGAGAAACCAGTAAGGG + Intronic
1169050034 20:2568285-2568307 TTCTCATCAGAAACCATGAAGGG + Intronic
1169872461 20:10262691-10262713 CTCGCAGGAGAAACCAGAAAGGG + Intronic
1170795940 20:19546752-19546774 GTCTAGGCAGAAACCAGGTTGGG - Intronic
1172791289 20:37507213-37507235 CTCACGACAGAAAACAGGAAAGG + Intronic
1173873500 20:46356111-46356133 CCCTCGGCAGAGCCCAGGAGCGG + Intronic
1174064547 20:47855007-47855029 CTCGCAGCAGAAGCCAGGGAGGG + Intergenic
1179134587 21:38668449-38668471 CTCTGGGCAGAAGCCAGAGAAGG - Intergenic
1179641845 21:42752892-42752914 CTCTCGGCAGAAACCAGGAATGG + Intronic
1180980140 22:19874507-19874529 CTCTGGGCAGCAGCCAGGAAGGG - Intergenic
1181327544 22:22061359-22061381 CTTTCGGCAGCAGCCAGGGAAGG + Intergenic
1181929090 22:26384965-26384987 ATCTTGGCAGAATCCAGGAATGG - Intergenic
1183256766 22:36767353-36767375 TCCTCGGCAGACAACAGGAATGG - Exonic
1183468151 22:37990476-37990498 CTCAGGGCAGACGCCAGGAAGGG - Intronic
1184274582 22:43403039-43403061 CTCTCCTCAGATTCCAGGAAAGG - Intergenic
1184511936 22:44939087-44939109 GTCTTGGCAGAAGGCAGGAAGGG - Intronic
1185262274 22:49874269-49874291 AACTCTGCACAAACCAGGAATGG - Intronic
949134223 3:543100-543122 CTCTCCGCTGAAAGCAGGAGAGG - Intergenic
949961339 3:9314823-9314845 CTCTGGGCAGAGGCCAGGGAGGG + Intronic
950188977 3:10963371-10963393 CTTGCGGCAGAAGCCAGGAGTGG + Intergenic
950685813 3:14618039-14618061 CTCTTGGGAGAAACCGGTAAGGG + Intergenic
951438889 3:22698799-22698821 TTCTCATCAGAAACCATGAAAGG + Intergenic
953057074 3:39396555-39396577 CCCTTGGCAGAAACCAAGCAGGG - Exonic
955634188 3:61008063-61008085 CTCTTGGGAGAAACCAGGAAGGG - Intronic
959059979 3:101607754-101607776 TTCTCAGCAGAAACAATGAAGGG - Intergenic
959830477 3:110855782-110855804 CTTTGGCCAGAAACCAGCAAAGG + Intergenic
960067992 3:113395634-113395656 CTCACTGCAGGAACCAGGAGTGG + Intronic
962975334 3:140441327-140441349 CTCTCAGGAGAGACAAGGAAAGG - Intronic
966948268 3:184793159-184793181 CTCTGGGTAGATACCAGTAATGG + Intergenic
967558351 3:190887130-190887152 CTGTGGGCAGAAACCAACAAGGG + Intronic
969476611 4:7425786-7425808 CTCGCTGGAGAAACGAGGAAGGG + Intronic
971708366 4:30078336-30078358 CTCTCAGCAGAAACCCTGCAAGG - Intergenic
972443267 4:39117599-39117621 GTCTCTGAAGAAAACAGGAAAGG + Intronic
975251805 4:72188832-72188854 CTCTCAGAAGAAATCAGCAATGG + Intergenic
976483030 4:85566932-85566954 TTCTAGGCAGAAATCAGCAAGGG + Intronic
979239302 4:118434280-118434302 CTGACTGCAGAGACCAGGAAGGG + Intergenic
983354520 4:166638345-166638367 ATCTCAGCAAAAGCCAGGAATGG - Intergenic
985658824 5:1145487-1145509 CTGTGGGCAGATTCCAGGAAGGG - Intergenic
985678713 5:1245152-1245174 CTCTTGTCACAGACCAGGAATGG - Intronic
986391871 5:7294686-7294708 CTCTAGGAAGGAACTAGGAAAGG - Intergenic
986472311 5:8088557-8088579 CTCTCGGCAGAAACCCTACAAGG - Intergenic
986560095 5:9052025-9052047 CTCTCTGCAGAGACCAGAAAAGG + Exonic
987458864 5:18182088-18182110 CTCTCAGAAGAAACCCTGAATGG - Intergenic
989532008 5:42518673-42518695 CTCATGGCAGAAATCAGAAATGG - Intronic
989758279 5:44982857-44982879 CTCTTTGAAGATACCAGGAAAGG + Intergenic
991532362 5:67629870-67629892 CTCACAGGAGAAAGCAGGAAAGG - Intergenic
993526214 5:88968966-88968988 CTCTAGGAAGAAAGGAGGAAAGG + Intergenic
994797045 5:104317150-104317172 CTTTCTGCAGAAAGCAGAAATGG + Intergenic
994856998 5:105135382-105135404 ATCTTAGCAGAAGCCAGGAATGG + Intergenic
996269509 5:121585693-121585715 ATCTCAACACAAACCAGGAATGG - Intergenic
998643770 5:144040688-144040710 CTCTGGGTAGAACCCTGGAAGGG + Intergenic
999642190 5:153682883-153682905 CTCTCAGCACCAAGCAGGAAAGG + Intronic
999711534 5:154322602-154322624 CTCCAGCCAGAAACCAGGCATGG - Intronic
1002739545 5:181424866-181424888 CTGACTGCAGAGACCAGGAAGGG + Intergenic
1003387199 6:5679764-5679786 CACTCAGGAAAAACCAGGAAAGG - Intronic
1004300940 6:14456489-14456511 CTCTCTGCATAACCCAGGATTGG + Intergenic
1006709042 6:36049335-36049357 ATCTCTGCAGACAACAGGAAAGG - Intronic
1007077571 6:39077812-39077834 GGCTCGGCAGAATCCTGGAATGG - Intronic
1007295589 6:40818436-40818458 CTCTGGGAAGAAACAAGGTAAGG + Intergenic
1007662188 6:43493643-43493665 CTTTAGGCAGAACCCCGGAAAGG + Intronic
1008918071 6:56811307-56811329 CTCTCAGCTGACACCAGGGAGGG + Intronic
1009530162 6:64803214-64803236 CTCTCTGCAGAGAGCTGGAAAGG - Intronic
1010483036 6:76377801-76377823 CTCTCAGCAGAAACTCAGAAGGG - Intergenic
1011549769 6:88520465-88520487 CTCTAGGGAAAAAGCAGGAAAGG + Intergenic
1011572585 6:88755063-88755085 GTCTTGGCAGAAACCTGTAAAGG + Intronic
1013227490 6:108130651-108130673 ATCTCAGCAGAAGCCAGGAATGG - Intronic
1013451552 6:110286598-110286620 CCCTGGGCAGAAGCCATGAATGG - Intronic
1015128658 6:129785119-129785141 ATCTAGGCAGAAGCCGGGAATGG + Intergenic
1017058189 6:150456493-150456515 CTCCCAGGAGAAACCAGGAATGG + Intergenic
1019244662 6:170700437-170700459 CTGACTGCAGAGACCAGGAAGGG + Intergenic
1020346808 7:7174089-7174111 CTCTCAGCATACACGAGGAAAGG - Intronic
1022217171 7:28274908-28274930 CTCACATCAGAAACCAGGAATGG + Intergenic
1022522031 7:31014555-31014577 TGCTCGGCAGAAAGCAGGCATGG + Intergenic
1022941664 7:35247454-35247476 TTCTCGGAAGAGACCAGAAAGGG - Intronic
1023036439 7:36135564-36135586 CTCCCCCCAGAAACCAGAAAAGG + Intergenic
1024256104 7:47541009-47541031 CACTCGGGAGAAAGCAGGAGTGG + Intronic
1024562650 7:50657417-50657439 CTCTCTGCAGAATCCTGGAAGGG - Intronic
1025592249 7:62876326-62876348 CTTTTGGCAGAAACCATGATGGG + Intergenic
1025595470 7:62918824-62918846 CTATCAGCAGAATCCATGAAGGG + Intergenic
1025771921 7:64516317-64516339 CTCTAGGAATATACCAGGAAAGG + Intergenic
1028198633 7:87935003-87935025 CTCCAGGCAGGAACCGGGAAAGG - Intronic
1030671801 7:112345981-112346003 CACTCTGCAGACACCATGAAAGG + Intergenic
1031332560 7:120484098-120484120 CTCTCAGCAAAAAGCAGGAGAGG + Intronic
1031487472 7:122345669-122345691 TTCACAACAGAAACCAGGAATGG - Exonic
1033077998 7:138267716-138267738 CTCTGGCCAAAGACCAGGAAAGG + Intergenic
1035212401 7:157337544-157337566 CTCGCGTCTGAAACCAGAAACGG + Intronic
1035503465 8:107739-107761 CTGACTGCAGAGACCAGGAAGGG - Intergenic
1037928616 8:22864722-22864744 TTCTCGGCAGAGCTCAGGAAAGG + Intronic
1039128334 8:34230293-34230315 TGCTGGGCAGAACCCAGGAAGGG - Intergenic
1039833081 8:41233312-41233334 CTCTTGAAAGTAACCAGGAAAGG + Intergenic
1040377800 8:46843220-46843242 CTCTAGGCAGAACCTAGAAAGGG - Intergenic
1041114195 8:54518552-54518574 CCTTCGGCAGAAATCAGGATTGG - Intergenic
1041480128 8:58310867-58310889 CTCAAGGCAGAATCCAGAAAAGG - Intergenic
1043380745 8:79699508-79699530 CTCACAGCAGATACCAGGAATGG + Intergenic
1044317958 8:90771668-90771690 CTCTCAGAAGAAACCAGTCAGGG + Intronic
1045199856 8:99969037-99969059 CTCTCGGCAGAAACCCCATAGGG + Intronic
1046381530 8:113456575-113456597 CTCACGGCAGAAGGCAGAAAGGG + Intergenic
1047313115 8:123708811-123708833 TTCCCGGCAGAAGCCAGGAGGGG - Intronic
1049416346 8:142497338-142497360 CTCTCCAAGGAAACCAGGAAAGG - Intronic
1055278086 9:74642209-74642231 CTGTGGGCATAAACCAGGACAGG + Intronic
1057835956 9:98445536-98445558 TTCTCGGAAGAAACCTGTAAGGG + Intronic
1058816283 9:108685462-108685484 CTCTCGGCTGACTCCAGAAATGG - Intergenic
1059295333 9:113265252-113265274 CACTCGGAAGAGACTAGGAATGG - Intronic
1061060103 9:128246002-128246024 CTGACTGCAGAGACCAGGAAGGG - Intronic
1061273443 9:129556891-129556913 CGCTGGGCAGAAACCAGGAGAGG + Intergenic
1061656996 9:132099881-132099903 CTCTGGGCAGAAGTCAGCAAAGG + Intergenic
1061993402 9:134172347-134172369 CTCTCTGCAGAAGCAGGGAACGG - Intergenic
1203604851 Un_KI270748v1:49667-49689 CTGACTGCAGAGACCAGGAAGGG + Intergenic
1186507904 X:10108794-10108816 TTCTAGGGAGAAACTAGGAATGG - Intronic
1186656118 X:11613953-11613975 CCCTTGGCAGGAACCAGGAAGGG + Intronic
1186704423 X:12126867-12126889 CTGGAGGCAGAAACCAGTAAGGG - Intergenic
1188844595 X:35057918-35057940 CTCCCTGCAGAAAGGAGGAATGG + Intergenic
1189759529 X:44306825-44306847 CTCTTGGGAGAAACCTGTAAGGG + Intronic
1190827878 X:54034348-54034370 CTCTCATCAGAAACCATGGAGGG + Intronic
1191162557 X:57346903-57346925 CTCTCAGCAGAAACCTTTAAAGG - Intronic
1192733780 X:73828745-73828767 CTTTCAGCAGAAAGCAGAAATGG + Intergenic
1193786352 X:85764001-85764023 CTCACAGCTGAAACCAGGACTGG + Intergenic
1199717139 X:150514997-150515019 CTCTCAGCAGGAAGCAGGAGGGG - Intergenic
1200747544 Y:6915787-6915809 CTCCCAGCAGAAAACTGGAAAGG - Intronic