ID: 1179642508 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 21:42756803-42756825 |
Sequence | TCAGCCCCGGGCGGGCACGA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 163 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 7, 4: 155} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1179642508_1179642515 | 8 | Left | 1179642508 | 21:42756803-42756825 | CCCTCGTGCCCGCCCGGGGCTGA | 0: 1 1: 0 2: 0 3: 7 4: 155 |
||
Right | 1179642515 | 21:42756834-42756856 | CGTGCAGCCACAGATGCATCCGG | 0: 1 1: 0 2: 2 3: 10 4: 101 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1179642508 | Original CRISPR | TCAGCCCCGGGCGGGCACGA GGG (reversed) | Intronic | ||