ID: 1179642508

View in Genome Browser
Species Human (GRCh38)
Location 21:42756803-42756825
Sequence TCAGCCCCGGGCGGGCACGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179642508_1179642515 8 Left 1179642508 21:42756803-42756825 CCCTCGTGCCCGCCCGGGGCTGA 0: 1
1: 0
2: 0
3: 7
4: 155
Right 1179642515 21:42756834-42756856 CGTGCAGCCACAGATGCATCCGG 0: 1
1: 0
2: 2
3: 10
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179642508 Original CRISPR TCAGCCCCGGGCGGGCACGA GGG (reversed) Intronic