ID: 1179644640

View in Genome Browser
Species Human (GRCh38)
Location 21:42767895-42767917
Sequence CCTAGGGAACAGCAGAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 221}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179644628_1179644640 28 Left 1179644628 21:42767844-42767866 CCAAGCTGAGACAGAGCTACCTG 0: 1
1: 0
2: 11
3: 19
4: 186
Right 1179644640 21:42767895-42767917 CCTAGGGAACAGCAGAAAATAGG 0: 1
1: 0
2: 1
3: 19
4: 221
1179644631_1179644640 9 Left 1179644631 21:42767863-42767885 CCTGTCCCCTGGGAAGATGAGCA 0: 1
1: 0
2: 0
3: 22
4: 239
Right 1179644640 21:42767895-42767917 CCTAGGGAACAGCAGAAAATAGG 0: 1
1: 0
2: 1
3: 19
4: 221
1179644633_1179644640 3 Left 1179644633 21:42767869-42767891 CCCTGGGAAGATGAGCAATGCAC 0: 1
1: 0
2: 2
3: 10
4: 144
Right 1179644640 21:42767895-42767917 CCTAGGGAACAGCAGAAAATAGG 0: 1
1: 0
2: 1
3: 19
4: 221
1179644632_1179644640 4 Left 1179644632 21:42767868-42767890 CCCCTGGGAAGATGAGCAATGCA 0: 1
1: 0
2: 0
3: 23
4: 222
Right 1179644640 21:42767895-42767917 CCTAGGGAACAGCAGAAAATAGG 0: 1
1: 0
2: 1
3: 19
4: 221
1179644634_1179644640 2 Left 1179644634 21:42767870-42767892 CCTGGGAAGATGAGCAATGCACC 0: 1
1: 0
2: 1
3: 14
4: 121
Right 1179644640 21:42767895-42767917 CCTAGGGAACAGCAGAAAATAGG 0: 1
1: 0
2: 1
3: 19
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179644640 Original CRISPR CCTAGGGAACAGCAGAAAAT AGG Intronic
901200064 1:7461715-7461737 CCAAGGAAACAGCATAAAAGGGG + Intronic
905175578 1:36133410-36133432 CCTAAGGAACATCAGGAAACAGG + Intergenic
905872010 1:41409843-41409865 CCTGGAGTACAGCAGAGAATGGG + Intergenic
909112928 1:71503012-71503034 CCTAGGGAACAATAGAAAGAGGG + Intronic
909171101 1:72296983-72297005 TGTATGGAACATCAGAAAATCGG - Intergenic
909329600 1:74395796-74395818 CCTAGGGAACAGAGGAAAGAGGG + Intronic
911465411 1:98246699-98246721 CCTAGGGAACAACTGAAAGTTGG - Intergenic
912170258 1:107091376-107091398 GCTAAGGAAGAGGAGAAAATGGG - Intergenic
912932191 1:113973779-113973801 CCTTGGTAACTGCAGAAGATGGG - Exonic
914033331 1:143977735-143977757 TCTATGGAACAGCACAGAATTGG + Intergenic
915261882 1:154682664-154682686 ATTAGAGAGCAGCAGAAAATAGG + Intergenic
915379389 1:155426907-155426929 CCTGGGGATCAGAAGGAAATTGG - Intronic
916097368 1:161363243-161363265 CCGAGGGAAGAGGAGGAAATTGG - Exonic
919233093 1:194801311-194801333 ACTTGGGAACAGTACAAAATTGG - Intergenic
919711464 1:200733501-200733523 GGGAGGTAACAGCAGAAAATGGG - Intergenic
919738979 1:200971317-200971339 CATCAGAAACAGCAGAAAATGGG + Intronic
920075544 1:203333824-203333846 CCTAGGGAACAAATGGAAATGGG + Intergenic
923327624 1:232894865-232894887 CCAATGGAACAGTAGAAAATGGG - Intergenic
923445497 1:234066916-234066938 CCTAATGAACTGCAGAAAGTGGG - Intronic
1062848945 10:728713-728735 CCCAGGCCACAGCAGCAAATGGG - Intergenic
1065056991 10:21855954-21855976 CCTGACGAAAAGCAGAAAATAGG + Intronic
1065860425 10:29867903-29867925 AGAAGGGAACAGCAGAAACTGGG - Intergenic
1069101252 10:64323719-64323741 TCTAGGGGATAGAAGAAAATAGG + Intergenic
1069348127 10:67494009-67494031 CTCAGGGGACAGAAGAAAATGGG + Intronic
1072053680 10:91731743-91731765 CCAAGGGAACAACAGATACTGGG - Intergenic
1072191955 10:93083202-93083224 TCTACTAAACAGCAGAAAATGGG + Intergenic
1072840452 10:98768679-98768701 CCAAGGGAACAGAATAAATTTGG - Intronic
1072854938 10:98936582-98936604 CATAGGGAAGAGCAGAAACAGGG - Intronic
1073882617 10:108000980-108001002 CTTTGGAAACAGCAGAAAATAGG + Intergenic
1074983356 10:118637235-118637257 CCTAGGAACCAGCAGGAACTGGG - Intergenic
1077988742 11:7382280-7382302 ACTATGGAAAAGGAGAAAATTGG + Intronic
1078435132 11:11318452-11318474 CCAAGGGACCAGCAGAAGTTAGG + Intronic
1080566142 11:33511208-33511230 CCAAAGTCACAGCAGAAAATTGG - Intergenic
1081202655 11:40236600-40236622 TCTAGGGAAAGGCAGAAAAAAGG + Intronic
1085795335 11:79534073-79534095 TCTAGAGAAAAGAAGAAAATGGG - Intergenic
1085965866 11:81525271-81525293 AGAAGGGAACAGCAGACAATGGG - Intergenic
1089909804 11:122086011-122086033 CACAGGGAACAAGAGAAAATGGG + Intergenic
1090951334 11:131476168-131476190 CCTAGGCAAGAACATAAAATGGG - Intronic
1094275105 12:28666056-28666078 TCTAGAGACCAGCAGAAAAGAGG + Intergenic
1094441757 12:30485616-30485638 CAGAGGGAGCAGCAGGAAATGGG - Intergenic
1096048587 12:48586406-48586428 CCTAGGGAACAGGAAGAGATAGG + Intergenic
1098283782 12:68887420-68887442 CTCAGGGAACAGCAGATACTGGG + Intronic
1099037331 12:77605040-77605062 CCAAGGGGACAGGAGAAAAGGGG + Intergenic
1099338439 12:81395659-81395681 ACTAGAGAAGAGCAGAAATTGGG + Intronic
1099648008 12:85384548-85384570 CCTATGGAACAGATCAAAATTGG - Intergenic
1100846066 12:98659425-98659447 CCTATAGAACAGCAGGAAAAAGG - Intronic
1103443735 12:120980749-120980771 CCTAGGGACCAGCAGAGACCTGG + Intronic
1104655373 12:130570514-130570536 CCTGAGGAACAGCATAAAACAGG + Intronic
1107094629 13:36522233-36522255 CCATGATAACAGCAGAAAATGGG - Intergenic
1107369339 13:39726287-39726309 CCTAGAAAATAGCAGAAACTCGG - Intronic
1108087590 13:46810239-46810261 CCTATGAAACTCCAGAAAATTGG - Intergenic
1112261591 13:97882525-97882547 GGTAGGGACAAGCAGAAAATGGG + Intergenic
1112641607 13:101281692-101281714 TCTATGGAACAGGGGAAAATTGG + Intronic
1113124136 13:106957748-106957770 CCTATGGAGGAGGAGAAAATGGG + Intergenic
1113357060 13:109590985-109591007 CCTGAGGAGCAGCTGAAAATGGG + Intergenic
1113973649 13:114210558-114210580 CCACGGGAGCAGAAGAAAATAGG - Intergenic
1120470659 14:84919454-84919476 CCTTGGCAACAACAGAAACTGGG - Intergenic
1120563351 14:86024018-86024040 CCAAGGGAATAGCAGATAATGGG + Intergenic
1121592666 14:95129207-95129229 CCTTGGCAACAACAGCAAATAGG + Intronic
1121746852 14:96302799-96302821 CCTAGTGATCAGTACAAAATAGG - Intronic
1122854690 14:104554442-104554464 CTTAGGGAACAGCAGGACAGAGG - Intronic
1124950305 15:34312601-34312623 CGAAGGGAAAAGCAGAAACTCGG - Intronic
1126316659 15:47377297-47377319 CTTTGGAAACATCAGAAAATAGG + Intronic
1126799004 15:52283304-52283326 CCCAGGGAACTGGTGAAAATAGG - Intronic
1126958389 15:53961068-53961090 CCTAGGAACCATCAAAAAATAGG - Intergenic
1128364392 15:66987063-66987085 CCTTGGGACTAACAGAAAATTGG - Intergenic
1128896369 15:71377384-71377406 CCTAGGAGACAGCAGGAAAGGGG + Intronic
1130243768 15:82223627-82223649 CATAGGGAATATCAGAGAATTGG - Intronic
1130456709 15:84117652-84117674 CATAGGGAATATCAGAGAATTGG + Intergenic
1131744162 15:95427949-95427971 CCTTGGTATCAGCAGAAGATTGG - Intergenic
1132196025 15:99915459-99915481 CCCAGGGAATAGCAGGACATTGG + Intergenic
1135755983 16:25098590-25098612 CCATGGGAACAGGAGAAAAAAGG - Intergenic
1136564734 16:31063156-31063178 CCTGGGGAACAGGAAAAAAAAGG - Intronic
1137014456 16:35361177-35361199 CCTAGGCTACTGGAGAAAATAGG + Intergenic
1137342217 16:47619629-47619651 CCTAGGCAACAGAAGATGATGGG - Intronic
1142864639 17:2783150-2783172 CGGAGGGAACAGCAGAAGAACGG - Intronic
1144833153 17:18142865-18142887 CCAAGGGGACAGCAGAGAAGGGG + Intronic
1146447070 17:32940764-32940786 CCTAGGGAAAAAAAGAAAATAGG - Exonic
1148101116 17:45092230-45092252 CCTAGTGTACAGCAGGAAAAAGG - Intronic
1148862556 17:50612306-50612328 CCTAGGGAAAGGCAGAAGAGCGG + Intronic
1149921428 17:60663484-60663506 CTTAGGGGCCAGAAGAAAATTGG + Exonic
1150900207 17:69266261-69266283 GCTAGGAAAGAGCAAAAAATGGG + Intronic
1151838134 17:76597583-76597605 ACTAGGGACCAGCAGCAAAAAGG - Intergenic
1153819958 18:8824678-8824700 CCCTGGGAAAAGCAGAAAAGAGG - Exonic
1154065370 18:11102511-11102533 CCTAGGGCAGAGCAGAGGATGGG + Intronic
1155060091 18:22220631-22220653 ACAGGGGAACAGCAGACAATAGG - Intergenic
1159886216 18:73909799-73909821 CTTAGAAGACAGCAGAAAATAGG - Intergenic
1167188978 19:47969629-47969651 CCTAAGGAACAGCAGATTGTAGG + Intronic
1167451745 19:49574590-49574612 CCTCAGGAACTGGAGAAAATAGG - Intronic
1167958065 19:53083939-53083961 AGTAGGGAACAGGGGAAAATGGG - Intronic
1168367072 19:55797479-55797501 CCTGGGATACAGCAGAAAACTGG + Intronic
925874840 2:8302788-8302810 CCTAGGGAAGAGCAGAGAAAGGG + Intergenic
925930319 2:8702144-8702166 CACAGGGAACAGCAGAGAAAGGG - Intergenic
926322371 2:11757925-11757947 GCTAGGGAGAAGCGGAAAATAGG - Intronic
927296024 2:21453925-21453947 CCTGGGGAACAGCAAGAAGTTGG - Intergenic
927666713 2:25037967-25037989 CCTGGGGGACAGCAGAGAATTGG + Intergenic
930920609 2:56748937-56748959 TCTAGGGGACAGTAGACAATAGG - Intergenic
934732151 2:96666167-96666189 CCCAGGGCACTGCAGAAAACTGG + Intergenic
935507480 2:103923791-103923813 CCAAGGGAAGAGAAGAAATTAGG + Intergenic
938776670 2:134547029-134547051 ACTAGGGGACAGGGGAAAATGGG + Intronic
939798703 2:146680317-146680339 CCTAGAAAACTGCAGCAAATAGG + Intergenic
940870647 2:158857362-158857384 CATAGGCAACAAAAGAAAATTGG + Intronic
942393820 2:175524859-175524881 TTTAGGGAAGAGCAGAAAAGGGG + Intergenic
944414064 2:199466333-199466355 CCTCTGGGAAAGCAGAAAATGGG - Intronic
945454488 2:210034400-210034422 CCAAGGGAACAGGACAAATTTGG + Intronic
945822465 2:214681327-214681349 CATAGAGAACAGAAGGAAATTGG + Intergenic
946326222 2:218985837-218985859 TCTAGGGAAGAGCAGAGAGTGGG - Intergenic
946347156 2:219119803-219119825 CCAAGGAAACAGGAGAAGATTGG - Intronic
1171445505 20:25200350-25200372 CCTACAGAACAGGAGAAAACAGG - Intronic
1171995648 20:31728873-31728895 CCTAGGGAACAAGATGAAATTGG + Intergenic
1173044271 20:39494418-39494440 TCTAGGGCTCAGCAGAAAATGGG - Intergenic
1174124675 20:48295128-48295150 CCTAGGTCAAAGCAGAAAATGGG - Intergenic
1176670326 21:9728137-9728159 TCTAGGAAACAGAAGAAAAATGG + Intergenic
1177911551 21:27039719-27039741 CCAAGGGAACATCACAACATGGG - Intergenic
1177960558 21:27660947-27660969 CGCAGGGTACAGCAGCAAATGGG - Intergenic
1178985375 21:37298645-37298667 CCCAGGGGACAGCAGAACAGGGG - Intergenic
1179303657 21:40135527-40135549 TCTGGGAAAAAGCAGAAAATGGG + Intronic
1179644640 21:42767895-42767917 CCTAGGGAACAGCAGAAAATAGG + Intronic
1182173040 22:28252858-28252880 CCAAAAGAACAGCATAAAATGGG + Intronic
1182419626 22:30242651-30242673 GCAAGGGAACAGCAGAACTTAGG - Exonic
1182692820 22:32175846-32175868 TCCAGGGAACAGAAGAAAAAAGG - Intergenic
1183319977 22:37159333-37159355 CTTGGGGAAAAGCAAAAAATGGG + Intronic
1184304274 22:43584886-43584908 CCTAGGGAAACCCAGAAAACAGG + Intronic
950525979 3:13523526-13523548 GCTGGGCCACAGCAGAAAATGGG + Intergenic
951054587 3:18132984-18133006 CCTTTGGAAGAGCAGAAAAGAGG + Intronic
951063068 3:18233278-18233300 CCAAGGGAGCAGCAGACATTGGG + Intronic
951767406 3:26215197-26215219 CCTAGTGAAGAGCAGGAGATTGG + Intergenic
951954996 3:28243716-28243738 CCTAGGGAACAGTAGTACATAGG + Intronic
952055623 3:29441668-29441690 CTTAGGGACCTTCAGAAAATAGG + Intronic
952476858 3:33718774-33718796 CCTAGGGAAGAGCAGATAATTGG - Intergenic
952561051 3:34593806-34593828 CCTTGGAAACTACAGAAAATTGG - Intergenic
955484041 3:59417893-59417915 CCCAGGGAAATGCAGACAATAGG + Intergenic
955777610 3:62450395-62450417 CCTAGGGCACAGGAGACAAAGGG + Intronic
956268420 3:67424255-67424277 CCTGGGGAAGAGGAGAAAAAGGG + Intronic
956730930 3:72195903-72195925 ACTACGGAACAGGAAAAAATTGG + Intergenic
959006846 3:101029166-101029188 ACTGGGGAACAACAGAAACTGGG - Intergenic
960017556 3:112909495-112909517 CCTAGGCAAAAGAATAAAATTGG - Intergenic
960326972 3:116309079-116309101 CCTACGGAACACAATAAAATGGG + Intronic
960444790 3:117734431-117734453 ACTAGGGAAGAGAAGGAAATGGG + Intergenic
960705986 3:120481360-120481382 CCTAGGGAACAGGAAGAAAATGG + Intergenic
960971921 3:123145934-123145956 CCCAGGGAACAACTGAACATTGG - Intronic
961630328 3:128294040-128294062 CCAAGGGCACAGCAGAAGGTAGG - Intronic
963105986 3:141647616-141647638 CCTTGGGAAAGGCAGAAAACAGG - Intergenic
964558172 3:157964045-157964067 CCTGGAGAACAGCAGACAAAGGG - Intergenic
969705138 4:8787614-8787636 CCCAGGGACCAGCAGTAAAGAGG + Intergenic
970447768 4:16138458-16138480 CCGAGGAAAGAGCAGAAACTTGG + Intergenic
970870702 4:20813775-20813797 CTTAGGAAACAGGAAAAAATTGG + Intronic
971355321 4:25890080-25890102 TCTACGGAACAGCAAGAAATAGG - Intronic
971455519 4:26840539-26840561 CCAGGGGAACAGCAGAAAAATGG - Intergenic
971521744 4:27561257-27561279 CCTACAGAATAGAAGAAAATTGG + Intergenic
972523492 4:39884671-39884693 CATAGTCAAAAGCAGAAAATTGG - Intronic
974373116 4:61042901-61042923 CCAAGGGAACTACAAAAAATAGG + Intergenic
975059395 4:69978652-69978674 CCTGGGGAAGAGCAGAGACTTGG + Intergenic
975430062 4:74278778-74278800 CCTAGAGTAAAGCAGAAAAAAGG + Intronic
976134304 4:81919525-81919547 GCTAGGGGACAGGTGAAAATAGG - Intronic
977024566 4:91800123-91800145 CCAAGGGAAGAGCAAAAAAGTGG + Intergenic
977440714 4:97063677-97063699 CATTGTGAACAGCAGACAATAGG - Intergenic
978370083 4:108021042-108021064 CTTAGGGGATAGGAGAAAATAGG - Intronic
978799278 4:112739658-112739680 CTAAGGGAACATCAGGAAATGGG - Intergenic
979670309 4:123354394-123354416 CCTAGGTAACAGCAGTGCATAGG + Intergenic
981335248 4:143562168-143562190 CCTAGTGGTCATCAGAAAATGGG - Intergenic
985291030 4:188388125-188388147 TCTAAGAAACAGAAGAAAATCGG - Intergenic
986530388 5:8730971-8730993 ACTAGGGAGCATCAGAAAGTGGG + Intergenic
986957856 5:13176826-13176848 ATTAGGGAACAGAAAAAAATGGG + Intergenic
989982117 5:50657422-50657444 CCTAGGGAAATGCAGTGAATTGG + Intergenic
992487282 5:77209779-77209801 CCTAAGGAAGAGGTGAAAATGGG + Intergenic
994563207 5:101404267-101404289 ACTAGGTAACAACAAAAAATGGG + Intergenic
995328513 5:110919554-110919576 CCCAGGGCACAGCAGAAGAGAGG - Intergenic
995410221 5:111848853-111848875 CCTAAGAAACAGCAGTGAATGGG + Intronic
995663436 5:114512442-114512464 CTTAGGCAACAGTAGAAAATAGG + Intergenic
995777368 5:115738350-115738372 CCTAGGAAATAGCAGAACAGTGG + Intergenic
997471917 5:134122078-134122100 CCTTGGAAGCAGCAGAAAAGAGG - Intronic
997598790 5:135125585-135125607 CATAGGGAAAAGCAGAAATTGGG + Intronic
997945714 5:138199213-138199235 CCTAGGGTACAACAGATAATGGG + Intronic
998872441 5:146566018-146566040 CCGAGTGAACACCGGAAAATGGG + Intergenic
999320224 5:150609892-150609914 CCTTGGCCACACCAGAAAATGGG - Intronic
999514657 5:152288834-152288856 CTTAAGGAGGAGCAGAAAATGGG - Intergenic
999516504 5:152307222-152307244 CACAGGGAACAGAAGAAAAAAGG + Intergenic
1000044206 5:157508297-157508319 TTTAGGGAACAGAAGAAAAATGG + Intronic
1000113608 5:158133014-158133036 CACAGGGAACAGCAGAAGAAGGG + Intergenic
1000832503 5:166120672-166120694 CCTTGGGAAAAACAGAAAGTAGG - Intergenic
1001574970 5:172757424-172757446 TCTATGGAACAGCAATAAATTGG + Intergenic
1001786469 5:174418292-174418314 TCTAGGGGTCAGAAGAAAATGGG - Intergenic
1001998067 5:176177873-176177895 CCTAAGGCACAGCAGCAAACAGG - Intergenic
1002050993 5:176571175-176571197 CCCAGGGGACCCCAGAAAATAGG - Intronic
1004066720 6:12253653-12253675 CAAAGGGAACAGCATTAAATAGG + Intergenic
1004935018 6:20498785-20498807 CCTATGGCACAACAGCAAATTGG + Intergenic
1007079023 6:39085707-39085729 CCTGAGGAGCTGCAGAAAATAGG + Intronic
1007179830 6:39921953-39921975 ACTGGGGAACAGCAGACACTGGG - Intronic
1007931645 6:45697132-45697154 CATAGGGAGTAGTAGAAAATGGG + Intergenic
1009844050 6:69113951-69113973 CCTTGGGAACACAAGAAATTAGG - Intronic
1009868585 6:69428826-69428848 TCTAGGGAACAGCAATATATGGG - Intergenic
1011605434 6:89100185-89100207 CCAAGGGACCAGCAAAAAACCGG + Intronic
1012932583 6:105332205-105332227 CCAAGGGACCTGCAGAAAAAAGG + Intronic
1013340677 6:109212462-109212484 CTTATGGACCAGAAGAAAATAGG - Intergenic
1013516268 6:110889137-110889159 TCTCAAGAACAGCAGAAAATAGG + Intronic
1014762110 6:125367668-125367690 GCTGGGGACCAGCAGAAAAGTGG + Intergenic
1016734247 6:147459093-147459115 CCCAGGGAACATAAGAAATTAGG + Intergenic
1017027677 6:150195933-150195955 CCTTGGACACAGCAGAAGATGGG - Intronic
1018557675 6:165065398-165065420 CAAAGGGACCAGCCGAAAATGGG - Intergenic
1021586485 7:22214299-22214321 ACAAAGGAACAGAAGAAAATGGG + Intronic
1021808977 7:24384351-24384373 GCTAGGGAACAGAAGACAAAGGG + Intergenic
1022256313 7:28662059-28662081 CAAAGTGAACAGCAGAAAAAAGG + Intronic
1024146353 7:46521646-46521668 CCTAAGGAAGAGCAGTAAATGGG + Intergenic
1026846125 7:73700060-73700082 CCCAGGGAAGAGCAGAACCTGGG + Exonic
1029951979 7:104595909-104595931 CCTTGGGAACAACAGAATATTGG + Intronic
1030253093 7:107471350-107471372 CCTTGTGAAAAGAAGAAAATTGG - Exonic
1030689272 7:112516192-112516214 CCTAGGGGGCAGCAGAAGAAAGG - Intergenic
1032208333 7:129889087-129889109 CCTAGGGAATACTAGAAAGTAGG + Intronic
1032517745 7:132519447-132519469 CCTTGGGAACCACAGAAAAGGGG + Intronic
1032693137 7:134309761-134309783 CCTAGTAAACTGCAGGAAATTGG + Intronic
1032861075 7:135880028-135880050 CCTCAGGGACAGCAGAAAAGTGG - Intergenic
1035988810 8:4465007-4465029 CCTTGGGAAAGGAAGAAAATAGG + Intronic
1037473274 8:19231796-19231818 GATAGGGAACAGCAGACAAGTGG - Intergenic
1038042521 8:23736772-23736794 GCTAGCCAACAGCAGAAGATAGG - Intergenic
1041723186 8:60994554-60994576 CCTGTGAAACAGAAGAAAATAGG - Intergenic
1042451625 8:68954375-68954397 TCTAGGAAACAGCATAAAAATGG + Intergenic
1043176674 8:77030100-77030122 CACAGGGAACTGAAGAAAATGGG - Intergenic
1043601274 8:81941226-81941248 CCTAGGGTACAGGAGTAAGTAGG + Intergenic
1043955625 8:86356377-86356399 CCTAGTGAACATCAGAAAACAGG - Intronic
1044320521 8:90795836-90795858 TATAGGAAACAGCAGAAATTAGG + Intronic
1044389252 8:91629329-91629351 CCTAAGCAGCAACAGAAAATTGG - Intergenic
1048873885 8:138821453-138821475 CCAAGGGAAAAGGAGAGAATGGG + Intronic
1049049232 8:140181130-140181152 CTTAGGGAACTTCACAAAATGGG - Intronic
1049284903 8:141769336-141769358 CTGAGGGAACAGCAGAAACCAGG - Intergenic
1050762956 9:9096067-9096089 GCTAGAGAACAACAGGAAATGGG + Intronic
1051215810 9:14796141-14796163 CATAGGGAACAGCAGGATATGGG + Intronic
1057078952 9:92158079-92158101 CCTGGGCAAAAACAGAAAATTGG - Intergenic
1058346162 9:103965562-103965584 CAAAGGGAACAGCAGATACTGGG - Intergenic
1059049267 9:110905075-110905097 CCGAATGAACAGCAGTAAATAGG - Intronic
1059861251 9:118465100-118465122 ACTAAGGAAAAGAAGAAAATAGG + Intergenic
1060523402 9:124307429-124307451 CCTGGGGAGCAGCAGGAAACTGG - Intronic
1060644544 9:125266732-125266754 CAAAACGAACAGCAGAAAATAGG - Intronic
1186923176 X:14303996-14304018 GCTAGGGCAAAGCAGCAAATAGG + Intergenic
1188992586 X:36840713-36840735 CGAAGGGAACAGCAGACACTGGG - Intergenic
1191901396 X:66044206-66044228 CCTAGGGATCCCCAGAACATAGG - Intergenic
1192269918 X:69569281-69569303 GCTATGGAAAACCAGAAAATGGG + Intergenic
1192939031 X:75893408-75893430 AACAGGGACCAGCAGAAAATGGG - Intergenic
1195281465 X:103338667-103338689 CCTAGGGGAAAGCTGAAAACTGG - Intergenic
1196464507 X:115958610-115958632 CTCAGGGAAGAGAAGAAAATTGG + Intergenic
1197849730 X:130844860-130844882 CCCAGGGACCAGCAGACAATTGG - Intronic
1199583207 X:149381753-149381775 CTTAGGAAACAGCACACAATTGG + Intergenic