ID: 1179646629

View in Genome Browser
Species Human (GRCh38)
Location 21:42779927-42779949
Sequence CTCCCTCACCACCGAGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179646625_1179646629 1 Left 1179646625 21:42779903-42779925 CCCCAGCAGACTCACACATCACA No data
Right 1179646629 21:42779927-42779949 CTCCCTCACCACCGAGTCCCTGG No data
1179646624_1179646629 15 Left 1179646624 21:42779889-42779911 CCTCGCTAGGGCTGCCCCAGCAG No data
Right 1179646629 21:42779927-42779949 CTCCCTCACCACCGAGTCCCTGG No data
1179646626_1179646629 0 Left 1179646626 21:42779904-42779926 CCCAGCAGACTCACACATCACAC No data
Right 1179646629 21:42779927-42779949 CTCCCTCACCACCGAGTCCCTGG No data
1179646623_1179646629 23 Left 1179646623 21:42779881-42779903 CCTGTGTGCCTCGCTAGGGCTGC No data
Right 1179646629 21:42779927-42779949 CTCCCTCACCACCGAGTCCCTGG No data
1179646627_1179646629 -1 Left 1179646627 21:42779905-42779927 CCAGCAGACTCACACATCACACC No data
Right 1179646629 21:42779927-42779949 CTCCCTCACCACCGAGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179646629 Original CRISPR CTCCCTCACCACCGAGTCCC TGG Intergenic
No off target data available for this crispr