ID: 1179647407

View in Genome Browser
Species Human (GRCh38)
Location 21:42784329-42784351
Sequence TCACCTCGGGTCCTTTCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179647407_1179647414 -8 Left 1179647407 21:42784329-42784351 CCTCCCGAAAGGACCCGAGGTGA No data
Right 1179647414 21:42784344-42784366 CGAGGTGATACAGGCCCACAGGG No data
1179647407_1179647422 28 Left 1179647407 21:42784329-42784351 CCTCCCGAAAGGACCCGAGGTGA No data
Right 1179647422 21:42784380-42784402 CCTCCCCCGCTTCAGGTCCGGGG No data
1179647407_1179647420 27 Left 1179647407 21:42784329-42784351 CCTCCCGAAAGGACCCGAGGTGA No data
Right 1179647420 21:42784379-42784401 GCCTCCCCCGCTTCAGGTCCGGG No data
1179647407_1179647415 0 Left 1179647407 21:42784329-42784351 CCTCCCGAAAGGACCCGAGGTGA No data
Right 1179647415 21:42784352-42784374 TACAGGCCCACAGGGCAGTCTGG No data
1179647407_1179647419 26 Left 1179647407 21:42784329-42784351 CCTCCCGAAAGGACCCGAGGTGA No data
Right 1179647419 21:42784378-42784400 AGCCTCCCCCGCTTCAGGTCCGG No data
1179647407_1179647418 21 Left 1179647407 21:42784329-42784351 CCTCCCGAAAGGACCCGAGGTGA No data
Right 1179647418 21:42784373-42784395 GGCACAGCCTCCCCCGCTTCAGG No data
1179647407_1179647413 -9 Left 1179647407 21:42784329-42784351 CCTCCCGAAAGGACCCGAGGTGA No data
Right 1179647413 21:42784343-42784365 CCGAGGTGATACAGGCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179647407 Original CRISPR TCACCTCGGGTCCTTTCGGG AGG (reversed) Intergenic