ID: 1179647408

View in Genome Browser
Species Human (GRCh38)
Location 21:42784332-42784354
Sequence GTATCACCTCGGGTCCTTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179647408_1179647420 24 Left 1179647408 21:42784332-42784354 CCCGAAAGGACCCGAGGTGATAC No data
Right 1179647420 21:42784379-42784401 GCCTCCCCCGCTTCAGGTCCGGG No data
1179647408_1179647419 23 Left 1179647408 21:42784332-42784354 CCCGAAAGGACCCGAGGTGATAC No data
Right 1179647419 21:42784378-42784400 AGCCTCCCCCGCTTCAGGTCCGG No data
1179647408_1179647415 -3 Left 1179647408 21:42784332-42784354 CCCGAAAGGACCCGAGGTGATAC No data
Right 1179647415 21:42784352-42784374 TACAGGCCCACAGGGCAGTCTGG No data
1179647408_1179647422 25 Left 1179647408 21:42784332-42784354 CCCGAAAGGACCCGAGGTGATAC No data
Right 1179647422 21:42784380-42784402 CCTCCCCCGCTTCAGGTCCGGGG No data
1179647408_1179647418 18 Left 1179647408 21:42784332-42784354 CCCGAAAGGACCCGAGGTGATAC No data
Right 1179647418 21:42784373-42784395 GGCACAGCCTCCCCCGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179647408 Original CRISPR GTATCACCTCGGGTCCTTTC GGG (reversed) Intergenic