ID: 1179647412

View in Genome Browser
Species Human (GRCh38)
Location 21:42784343-42784365
Sequence CCTGTGGGCCTGTATCACCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179647412_1179647419 12 Left 1179647412 21:42784343-42784365 CCGAGGTGATACAGGCCCACAGG No data
Right 1179647419 21:42784378-42784400 AGCCTCCCCCGCTTCAGGTCCGG No data
1179647412_1179647418 7 Left 1179647412 21:42784343-42784365 CCGAGGTGATACAGGCCCACAGG No data
Right 1179647418 21:42784373-42784395 GGCACAGCCTCCCCCGCTTCAGG No data
1179647412_1179647420 13 Left 1179647412 21:42784343-42784365 CCGAGGTGATACAGGCCCACAGG No data
Right 1179647420 21:42784379-42784401 GCCTCCCCCGCTTCAGGTCCGGG No data
1179647412_1179647422 14 Left 1179647412 21:42784343-42784365 CCGAGGTGATACAGGCCCACAGG No data
Right 1179647422 21:42784380-42784402 CCTCCCCCGCTTCAGGTCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179647412 Original CRISPR CCTGTGGGCCTGTATCACCT CGG (reversed) Intergenic