ID: 1179647416

View in Genome Browser
Species Human (GRCh38)
Location 21:42784358-42784380
Sequence GCTGTGCCAGACTGCCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179647416_1179647428 27 Left 1179647416 21:42784358-42784380 CCCACAGGGCAGTCTGGCACAGC No data
Right 1179647428 21:42784408-42784430 TCACATCTACAAAGTTGCTTTGG No data
1179647416_1179647419 -3 Left 1179647416 21:42784358-42784380 CCCACAGGGCAGTCTGGCACAGC No data
Right 1179647419 21:42784378-42784400 AGCCTCCCCCGCTTCAGGTCCGG No data
1179647416_1179647422 -1 Left 1179647416 21:42784358-42784380 CCCACAGGGCAGTCTGGCACAGC No data
Right 1179647422 21:42784380-42784402 CCTCCCCCGCTTCAGGTCCGGGG No data
1179647416_1179647420 -2 Left 1179647416 21:42784358-42784380 CCCACAGGGCAGTCTGGCACAGC No data
Right 1179647420 21:42784379-42784401 GCCTCCCCCGCTTCAGGTCCGGG No data
1179647416_1179647418 -8 Left 1179647416 21:42784358-42784380 CCCACAGGGCAGTCTGGCACAGC No data
Right 1179647418 21:42784373-42784395 GGCACAGCCTCCCCCGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179647416 Original CRISPR GCTGTGCCAGACTGCCCTGT GGG (reversed) Intergenic