ID: 1179647422

View in Genome Browser
Species Human (GRCh38)
Location 21:42784380-42784402
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179647406_1179647422 29 Left 1179647406 21:42784328-42784350 CCCTCCCGAAAGGACCCGAGGTG No data
Right 1179647422 21:42784380-42784402 CCTCCCCCGCTTCAGGTCCGGGG No data
1179647412_1179647422 14 Left 1179647412 21:42784343-42784365 CCGAGGTGATACAGGCCCACAGG No data
Right 1179647422 21:42784380-42784402 CCTCCCCCGCTTCAGGTCCGGGG No data
1179647411_1179647422 15 Left 1179647411 21:42784342-42784364 CCCGAGGTGATACAGGCCCACAG No data
Right 1179647422 21:42784380-42784402 CCTCCCCCGCTTCAGGTCCGGGG No data
1179647416_1179647422 -1 Left 1179647416 21:42784358-42784380 CCCACAGGGCAGTCTGGCACAGC No data
Right 1179647422 21:42784380-42784402 CCTCCCCCGCTTCAGGTCCGGGG No data
1179647408_1179647422 25 Left 1179647408 21:42784332-42784354 CCCGAAAGGACCCGAGGTGATAC No data
Right 1179647422 21:42784380-42784402 CCTCCCCCGCTTCAGGTCCGGGG No data
1179647407_1179647422 28 Left 1179647407 21:42784329-42784351 CCTCCCGAAAGGACCCGAGGTGA No data
Right 1179647422 21:42784380-42784402 CCTCCCCCGCTTCAGGTCCGGGG No data
1179647417_1179647422 -2 Left 1179647417 21:42784359-42784381 CCACAGGGCAGTCTGGCACAGCC No data
Right 1179647422 21:42784380-42784402 CCTCCCCCGCTTCAGGTCCGGGG No data
1179647409_1179647422 24 Left 1179647409 21:42784333-42784355 CCGAAAGGACCCGAGGTGATACA No data
Right 1179647422 21:42784380-42784402 CCTCCCCCGCTTCAGGTCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179647422 Original CRISPR CCTCCCCCGCTTCAGGTCCG GGG Intergenic