ID: 1179647428

View in Genome Browser
Species Human (GRCh38)
Location 21:42784408-42784430
Sequence TCACATCTACAAAGTTGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179647426_1179647428 -1 Left 1179647426 21:42784386-42784408 CCGCTTCAGGTCCGGGGTTTAAT No data
Right 1179647428 21:42784408-42784430 TCACATCTACAAAGTTGCTTTGG No data
1179647421_1179647428 5 Left 1179647421 21:42784380-42784402 CCTCCCCCGCTTCAGGTCCGGGG No data
Right 1179647428 21:42784408-42784430 TCACATCTACAAAGTTGCTTTGG No data
1179647423_1179647428 2 Left 1179647423 21:42784383-42784405 CCCCCGCTTCAGGTCCGGGGTTT No data
Right 1179647428 21:42784408-42784430 TCACATCTACAAAGTTGCTTTGG No data
1179647416_1179647428 27 Left 1179647416 21:42784358-42784380 CCCACAGGGCAGTCTGGCACAGC No data
Right 1179647428 21:42784408-42784430 TCACATCTACAAAGTTGCTTTGG No data
1179647417_1179647428 26 Left 1179647417 21:42784359-42784381 CCACAGGGCAGTCTGGCACAGCC No data
Right 1179647428 21:42784408-42784430 TCACATCTACAAAGTTGCTTTGG No data
1179647425_1179647428 0 Left 1179647425 21:42784385-42784407 CCCGCTTCAGGTCCGGGGTTTAA No data
Right 1179647428 21:42784408-42784430 TCACATCTACAAAGTTGCTTTGG No data
1179647424_1179647428 1 Left 1179647424 21:42784384-42784406 CCCCGCTTCAGGTCCGGGGTTTA No data
Right 1179647428 21:42784408-42784430 TCACATCTACAAAGTTGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179647428 Original CRISPR TCACATCTACAAAGTTGCTT TGG Intergenic