ID: 1179647918

View in Genome Browser
Species Human (GRCh38)
Location 21:42786402-42786424
Sequence CCCCAACACAGCTGCAGCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179647918_1179647920 -7 Left 1179647918 21:42786402-42786424 CCATCGCTGCAGCTGTGTTGGGG No data
Right 1179647920 21:42786418-42786440 GTTGGGGTGCCTCTGCCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179647918 Original CRISPR CCCCAACACAGCTGCAGCGA TGG (reversed) Intergenic
No off target data available for this crispr