ID: 1179648734

View in Genome Browser
Species Human (GRCh38)
Location 21:42792872-42792894
Sequence TCCCCATCTGTCACACAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179648734_1179648740 2 Left 1179648734 21:42792872-42792894 CCAATTTGTGTGACAGATGGGGA No data
Right 1179648740 21:42792897-42792919 GCTGGGGTCCCATACAGAAGGGG No data
1179648734_1179648739 1 Left 1179648734 21:42792872-42792894 CCAATTTGTGTGACAGATGGGGA No data
Right 1179648739 21:42792896-42792918 AGCTGGGGTCCCATACAGAAGGG No data
1179648734_1179648738 0 Left 1179648734 21:42792872-42792894 CCAATTTGTGTGACAGATGGGGA No data
Right 1179648738 21:42792895-42792917 GAGCTGGGGTCCCATACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179648734 Original CRISPR TCCCCATCTGTCACACAAAT TGG (reversed) Intergenic