ID: 1179648739

View in Genome Browser
Species Human (GRCh38)
Location 21:42792896-42792918
Sequence AGCTGGGGTCCCATACAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179648734_1179648739 1 Left 1179648734 21:42792872-42792894 CCAATTTGTGTGACAGATGGGGA No data
Right 1179648739 21:42792896-42792918 AGCTGGGGTCCCATACAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179648739 Original CRISPR AGCTGGGGTCCCATACAGAA GGG Intergenic