ID: 1179648740 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 21:42792897-42792919 |
Sequence | GCTGGGGTCCCATACAGAAG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1179648734_1179648740 | 2 | Left | 1179648734 | 21:42792872-42792894 | CCAATTTGTGTGACAGATGGGGA | No data | ||
Right | 1179648740 | 21:42792897-42792919 | GCTGGGGTCCCATACAGAAGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1179648740 | Original CRISPR | GCTGGGGTCCCATACAGAAG GGG | Intergenic | ||