ID: 1179648822

View in Genome Browser
Species Human (GRCh38)
Location 21:42793372-42793394
Sequence TTCTGCTTGTAAGAGTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179648822_1179648825 23 Left 1179648822 21:42793372-42793394 CCTGGACACTCTTACAAGCAGAA No data
Right 1179648825 21:42793418-42793440 CATTAAACCGTCTTGCTCCCAGG No data
1179648822_1179648823 -6 Left 1179648822 21:42793372-42793394 CCTGGACACTCTTACAAGCAGAA No data
Right 1179648823 21:42793389-42793411 GCAGAAGACTTGAGCTGCTGAGG No data
1179648822_1179648824 -2 Left 1179648822 21:42793372-42793394 CCTGGACACTCTTACAAGCAGAA No data
Right 1179648824 21:42793393-42793415 AAGACTTGAGCTGCTGAGGAAGG No data
1179648822_1179648826 24 Left 1179648822 21:42793372-42793394 CCTGGACACTCTTACAAGCAGAA No data
Right 1179648826 21:42793419-42793441 ATTAAACCGTCTTGCTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179648822 Original CRISPR TTCTGCTTGTAAGAGTGTCC AGG (reversed) Intergenic
No off target data available for this crispr